Mutagenetix > Incidental Mutation

Incidental Mutation 'FR4548:Utrn'

512077

Institutional Source

Beutler Lab

Gene Symbol

Utrn

Ensembl Gene

ENSMUSG00000019820

Gene Name

utrophin

Synonyms

G-utrophin, DRP, Dmdl

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

FR4548 ()

Quality Score

214.458

Status

Not validated

Chromosome

Chromosomal Location

12382188-12869365 bp(-) (GRCm38)

Type of Mutation

critical splice donor site

DNA Base Change (assembly)

T to TTCCTGTC at 12633941 bp (GRCm38)

Zygosity

Homozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000151431 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076817] [ENSMUST00000218635]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000076817

SMART Domains

Protein: ENSMUSP00000076093
Gene: ENSMUSG00000019820

Domain	Start	End	E-Value	Type
CH	33	133	1.87e-24	SMART
CH	152	250	4.05e-20	SMART
SPEC	312	416	2.31e-18	SMART
SPEC	421	525	4.18e-16	SMART
SPEC	532	636	3.35e-6	SMART
low complexity region	665	679	N/A	INTRINSIC
SPEC	690	795	1.7e-7	SMART
SPEC	801	901	1e-4	SMART
SPEC	910	1012	8.24e-2	SMART
SPEC	1019	1121	1.32e-4	SMART
SPEC	1128	1229	2.64e-4	SMART
SPEC	1236	1333	4.42e-6	SMART
coiled coil region	1375	1401	N/A	INTRINSIC
SPEC	1438	1540	3.62e-2	SMART
SPEC	1547	1648	7.95e-1	SMART
SPEC	1655	1752	3.56e0	SMART
coiled coil region	1766	1795	N/A	INTRINSIC
SPEC	1870	1972	3.63e0	SMART
SPEC	1979	2080	5.15e-16	SMART
SPEC	2087	2183	3.71e0	SMART
SPEC	2227	2330	4.7e-10	SMART
SPEC	2337	2437	1.02e0	SMART
SPEC	2444	2553	2.35e-10	SMART
SPEC	2560	2685	8.77e-10	SMART
SPEC	2692	2794	4.13e-6	SMART
WW	2811	2843	5.59e-7	SMART
Pfam:EF-hand_2	2844	2962	3.8e-41	PFAM
Pfam:EF-hand_3	2966	3057	1.6e-39	PFAM
ZnF_ZZ	3062	3107	6.33e-17	SMART
coiled coil region	3250	3289	N/A	INTRINSIC
coiled coil region	3310	3354	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000218635

Coding Region Coverage

1x: 99.8%
3x: 99.5%
10x: 98.3%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares both structural and functional similarities with the dystrophin gene. It contains an actin-binding N-terminus, a triple coiled-coil repeat central region, and a C-terminus that consists of protein-protein interaction motifs which interact with dystroglycan protein components. The protein encoded by this gene is located at the neuromuscular synapse and myotendinous junctions, where it participates in post-synaptic membrane maintenance and acetylcholine receptor clustering. Mouse studies suggest that this gene may serve as a functional substitute for the dystrophin gene and therefore, may serve as a potential therapeutic alternative to muscular dystrophy which is caused by mutations in the dystrophin gene. Alternative splicing of the utrophin gene has been described; however, the full-length nature of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have reduced density of acetylcholine receptors and reduced number of junctional folds at neuromuscular junctions. Mice homozygous for utrophin and dystrophin knockouts die prematurely with severe, progressive muscular dystrophy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 147 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001K19Rik	CTT	CTTTTT	12: 110,668,449		probably benign	Het
1700001K19Rik	CTT	CTTTTT	12: 110,668,452		probably benign	Het
2010300C02Rik	T	A	1: 37,625,035	E594V	probably benign	Homo
2010300C02Rik	C	A	1: 37,625,036	E594*	probably null	Homo
2010300C02Rik	A	G	1: 37,625,102	S47P	probably damaging	Homo
4930433I11Rik	ACCTC	AC	7: 40,993,056		probably benign	Het
4932415D10Rik	G	GTCATTA	10: 82,290,996		probably benign	Homo
Abt1	TTCTTGCT	TT	13: 23,423,711		probably benign	Het
Ahdc1	TCC	TCCCCC	4: 133,062,757		probably benign	Homo
Ahdc1	T	TCCC	4: 133,062,760		probably benign	Homo
AI837181	CGG	CGGGGG	19: 5,425,231		probably benign	Het
AI837181	CG	CGGGG	19: 5,425,237		probably benign	Het
Anxa2	CCC	CCCTCC	9: 69,480,203		probably benign	Het
Anxa7	C	T	14: 20,469,411	G113E	probably damaging	Homo
Apc	CCAATAAAG	CCAATAAAGACAATAAAG	18: 34,281,998		probably benign	Het
Apol6	T	TGTTA	15: 77,051,445		probably null	Homo
BC051142	GCA	GCATCA	17: 34,460,065		probably benign	Het
Blm	CTAC	CTACTTAC	7: 80,463,769		probably null	Homo
Brd2	CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA	CAAAAAAAAAAAAAAA	17: 34,116,336		probably benign	Het
Bud31	C	T	5: 145,146,535	R63C	probably benign	Het
C4b	C	T	17: 34,740,997	R335H	probably benign	Het
Cacna1a	ACC	ACCCCC	8: 84,638,717		probably benign	Het
Cacna1f	AGG	AGGGGG	X: 7,620,058		probably benign	Het
Ccdc170	ACC	ACCCCC	10: 4,561,026		probably benign	Het
Cckbr	GGGC	G	7: 105,434,681		probably benign	Homo
Cd3eap	GGATG	GG	7: 19,357,244		probably benign	Homo
Cd80	GAAA	GAAAAAA	16: 38,486,319		probably benign	Homo
Ces1b	T	C	8: 93,068,092	N293S	probably null	Homo
Cgnl1	CGC	CGCGGC	9: 71,724,717		probably benign	Het
Cntnap1	CCCAGC	CCCAGCGCCAGC	11: 101,189,572		probably benign	Het
Cntnap1	CCAGCC	CCAGCCTCAGCC	11: 101,189,579		probably benign	Het
Cntnap1	AGCC	AGCCCCCGCC	11: 101,189,593		probably benign	Het
Cntnap1	GCC	GCCCCAACC	11: 101,189,594		probably benign	Het
Ctsm	GTGA	GTGAATGA	13: 61,537,837		probably null	Homo
Cttnbp2	TGCTGC	TGCTGCCGCTGC	6: 18,367,463		probably benign	Het
Dbr1	GAGGAG	GAGGAGTAGGAG	9: 99,583,673		probably null	Het
Dusp10	G	T	1: 184,037,056	C73F	probably damaging	Homo
Efna4	ATGTGAT	A	3: 89,334,422		probably benign	Homo
Eif3a	A	ATTTTT	19: 60,775,291		probably benign	Homo
Ermn	TTC	TTCATC	2: 58,048,075		probably benign	Het
Ermn	TC	TCTCC	2: 58,048,088		probably benign	Het
Fbxo43	GTGCCT	GTGCCTATGCCT	15: 36,152,098		probably null	Het
Fscb	A	G	12: 64,472,563	S710P	unknown	Het
Fscb	T	A	12: 64,472,565	Q709L	unknown	Het
Glod4	A	C	11: 76,243,310		probably benign	Homo
Gm14401	A	G	2: 177,086,868	D249G	probably benign	Het
Gm4340	AGC	AGCCGC	10: 104,196,070		probably benign	Het
Gm4340	AGC	AGCGGC	10: 104,196,073		probably benign	Het
Gm8104	C	T	14: 43,110,009	T178I	probably benign	Het
Gm8104	T	C	14: 43,110,011	S179P	probably damaging	Het
Gpatch11	GGAAGA	GGAAGACGAAGA	17: 78,842,175		probably benign	Het
H2-K1	GTTT	G	17: 33,997,042		probably benign	Homo
Hist1h1t	GAGAA	GA	13: 23,695,920		probably benign	Homo
Hspa1b	GCGCC	GC	17: 34,957,129		probably benign	Homo
Ifi211	G	A	1: 173,906,193	A134V	possibly damaging	Het
Igf1r	C	CTGGAGATGGAGG	7: 68,226,186		probably benign	Het
Igkv9-129	G	A	6: 67,840,034	V41I	probably damaging	Het
Ipo9	TCC	TCCCCC	1: 135,386,275		probably benign	Het
Kcng4	G	T	8: 119,633,519	Y39*	probably null	Homo
Klra2	AG	AGAAATCCACGG	6: 131,221,851		probably null	Het
Kmt2b	CTCC	CTCCTCGTCC	7: 30,586,380		probably benign	Het
Kng2	G	A	16: 23,000,552	Q245*	probably null	Het
Kri1	CTCCTCTTCCTC	CTCCTC	9: 21,281,050		probably benign	Het
Krt10	TCCTCC	TCCTCCCCCTCC	11: 99,389,273		probably benign	Het
Krt10	TCCTCCAC	TCCTCCACCTCCAC	11: 99,389,276		probably benign	Homo
Las1l	TC	TCTTCCGC	X: 95,940,625		probably benign	Het
Las1l	GAG	GAGAAG	X: 95,940,823		probably benign	Het
Lrit3	GCT	GCTACT	3: 129,788,813		probably benign	Het
Lrit3	GCT	GCTACT	3: 129,788,816		probably benign	Het
Lrrc63	CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG	CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG	14: 75,125,182		probably benign	Homo
Luzp1	CTCTTCAGA	CTCTTCAGAGGTGGCATCTTCAGA	4: 136,543,188		probably benign	Homo
Mast4	CA	CAGTGGGA	13: 102,736,318		probably benign	Homo
Med12l	AGC	AGCGGC	3: 59,275,982		probably benign	Het
Mn1	GCA	GCACCA	5: 111,419,698		probably benign	Het
Morn4	AGGCAGTGAG	AGGCAGTGAGTCCGGCAGTGAG	19: 42,076,109		probably benign	Het
Msantd4	A	T	9: 4,384,937	I221F	possibly damaging	Homo
Mup21	TATACTT	TATACTTTTTAAATACTT	4: 62,149,345		probably benign	Het
Mup21	ATACTT	ATACTTTTTATCTACTT	4: 62,149,346		probably benign	Het
Nacad	AGGGTC	AGGGTCGGGGTC	11: 6,599,752		probably benign	Het
Nacad	GG	GGCCAGTG	11: 6,599,760		probably benign	Het
Ncapd2	CTT	CTTGGTT	6: 125,173,596		probably benign	Homo
Nelfe	GACCGGGATCGAGACAGAGAC	GACCGGGATCGAGACAGAGACAAAGACCGGGATCGAGACAGAGAC	17: 34,854,070		probably benign	Homo
Nfxl1	CCGGGG	CCGGGGTCGGGG	5: 72,559,115		probably benign	Het
Nkx2-6	C	T	14: 69,175,229	T282M	probably damaging	Homo
Noc2l	AGGC	AGGCGGC	4: 156,240,092		probably benign	Homo
Noc2l	GC	GCTTC	4: 156,240,100		probably benign	Het
Nphp3	CACG	C	9: 104,025,939		probably benign	Het
Nrg3	TTG	TTGACACTG	14: 38,397,271		probably benign	Homo
Olfr313	T	A	11: 58,817,440	V144D	possibly damaging	Homo
Olfr318	T	G	11: 58,720,371	I226L	probably benign	Het
Olfr585	T	TTAG	7: 103,098,309		probably null	Homo
Olfr624	CAAA	CAAAAAA	7: 103,670,960		probably benign	Homo
Olfr624	G	GAAC	7: 103,670,967		probably null	Homo
Osmr	CTC	CTCTTC	15: 6,837,703		probably benign	Homo
Patl2	GCT	GCTCCT	2: 122,126,135		probably benign	Het
Pdik1l	ACCAC	ACCACCGCCAC	4: 134,279,512		probably benign	Homo
Phldb3	GACCC	G	7: 24,628,978		probably null	Het
Piezo1	G	A	8: 122,495,569	R503W	probably damaging	Homo
Pik3ap1	AG	AGGGG	19: 41,281,945		probably benign	Homo
Pkdrej	TG	TGGGAGCG	15: 85,819,680		probably benign	Homo
Ppp1r3f	C	A	X: 7,560,336	G562V	probably damaging	Homo
Prag1	GC	GCAAC	8: 36,103,885		probably benign	Homo
Prr13	TCC	TCCGCC	15: 102,462,174		probably benign	Het
Prtg	GTAAC	G	9: 72,857,081		probably benign	Homo
Ptk2b	C	T	14: 66,173,849	R411Q	possibly damaging	Het
Ptms	TTC	TTCGTC	6: 124,914,456		probably benign	Het
Ptpn23	G	T	9: 110,387,633	P1052T	probably benign	Homo
Rbm33	AGCAGCCGCAGC	AGCAGC	5: 28,394,201		probably benign	Het
Setd1a	TGGTGGTGGT	TGGTGGTGGTGGTGGTGGT	7: 127,785,307		probably benign	Homo
Setd1a	TGGTAGTGG	TGGTAGTGGCGGTAGTGG	7: 127,785,313		probably benign	Homo
Sfswap	AGCCCACTCGGCC	AGCCCACTCGGCCCACTCGGCC	5: 129,569,755		probably benign	Homo
Sfswap	CCACTCAGC	CCACTCAGCGCACTCAGC	5: 129,569,749		probably benign	Het
Sh3pxd2b	T	TGTCTTG	11: 32,423,065		probably benign	Het
Sh3pxd2b	GT	GTGTCTCT	11: 32,423,064		probably benign	Homo
Shroom4	GCAGCAACA	GCA	X: 6,624,074		probably benign	Het
Six3	GGC	GGCCGC	17: 85,621,363		probably benign	Het
Slc12a1	ACC	ACCTTTGGCCACAACCCC	2: 125,154,214		probably benign	Homo
Spaca1	GC	GCTCTCTC	4: 34,049,856		probably benign	Het
Spag17	AGG	AGGCGG	3: 100,056,254		probably benign	Het
Srebf2	G	T	15: 82,185,335	A693S	probably damaging	Homo
Supt20	GCAGCA	GCAGCACCAGCA	3: 54,727,657		probably benign	Het
Supt20	CAGCAG	CAGCAGGAGCAG	3: 54,727,664		probably benign	Het
Supt20	CA	CAGCAGAA	3: 54,727,673		probably benign	Het
Syne1	C	A	10: 5,032,969	S8652I	probably benign	Homo
Tob1	GCA	GCAACA	11: 94,214,455		probably benign	Het
Tob1	AGC	AGCCGC	11: 94,214,469		probably benign	Het
Tomm5	CTTCCGC	CTTCCGCATTTTCCGC	4: 45,107,977		probably benign	Het
Trav15-2-dv6-2	G	GAAA	14: 53,649,757		probably benign	Het
Triobp	TCG	TCGGCG	15: 78,993,387		probably benign	Het
Triobp	TCG	TCGCCG	15: 78,993,390		probably benign	Homo
Tsen2	GAG	GAGAAG	6: 115,560,068		probably benign	Het
Ttf2	TC	TCCGC	3: 100,963,160		probably benign	Homo
Tusc1	CGCCAC	CGCCACTGCCAC	4: 93,335,303		probably benign	Het
Ubtf	CTC	CTCATC	11: 102,306,958		probably benign	Het
Vars	TGG	TGGAGTCCTGGGGGG	17: 35,015,989		probably benign	Homo
Vars	G	GAGTCCTGGGTGC	17: 35,015,991		probably benign	Het
Vmn2r99	G	A	17: 19,394,285	G756R	probably damaging	Het
Vps13b	G	T	15: 35,846,957	A2629S	probably damaging	Homo
Zc3h13	TGCG	TGCGTGATGAGCG	14: 75,323,599		probably benign	Het
Zdhhc16	CACA	CACAACAGGGAAAGCAGTCTGTCAACA	19: 41,942,168		probably null	Het
Zfp26	C	A	9: 20,438,546	A241S	probably benign	Homo
Zfp335	TCC	TCCCCC	2: 164,907,472		probably benign	Het
Zfp598	CACCAC	CACCACAACCAC	17: 24,680,775		probably benign	Het
Zfp598	ACCACC	ACCACCCCCACC	17: 24,680,776		probably benign	Het
Zfp933	TT	TTTGCCT	4: 147,825,731		probably null	Het
Zfp986	G	T	4: 145,899,358	R196I	probably benign	Het
Zfp992	G	T	4: 146,466,007	E62*	probably null	Het

Other mutations in Utrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Utrn	APN	10	12671830	missense	probably damaging	1.00
IGL00469:Utrn	APN	10	12406529	missense	probably damaging	1.00
IGL00518:Utrn	APN	10	12666843	splice site	probably benign
IGL00560:Utrn	APN	10	12455467	nonsense	probably null
IGL00589:Utrn	APN	10	12678618	missense	possibly damaging	0.53
IGL00662:Utrn	APN	10	12664961	missense	probably damaging	0.99
IGL00754:Utrn	APN	10	12663492	missense	probably benign	0.05
IGL00772:Utrn	APN	10	12649185	missense	probably benign
IGL00775:Utrn	APN	10	12745230	critical splice donor site	probably null
IGL00782:Utrn	APN	10	12652811	missense	probably benign	0.13
IGL00962:Utrn	APN	10	12481334	missense	possibly damaging	0.80
IGL01584:Utrn	APN	10	12726367	missense	probably benign	0.01
IGL01677:Utrn	APN	10	12744157	missense	probably damaging	1.00
IGL01695:Utrn	APN	10	12745342	missense	probably benign	0.00
IGL01743:Utrn	APN	10	12711557	missense	possibly damaging	0.94
IGL01815:Utrn	APN	10	12652716	missense	probably benign	0.00
IGL01901:Utrn	APN	10	12640928	missense	probably damaging	1.00
IGL01982:Utrn	APN	10	12748029	missense	probably damaging	1.00
IGL01983:Utrn	APN	10	12669781	missense	probably benign	0.18
IGL02031:Utrn	APN	10	12735204	missense	probably damaging	1.00
IGL02106:Utrn	APN	10	12413973	missense	possibly damaging	0.92
IGL02134:Utrn	APN	10	12643419	missense	probably damaging	0.99
IGL02209:Utrn	APN	10	12683295	missense	probably damaging	0.97
IGL02217:Utrn	APN	10	12751559	missense	probably damaging	1.00
IGL02250:Utrn	APN	10	12436391	missense	probably damaging	1.00
IGL02307:Utrn	APN	10	12750065	nonsense	probably null
IGL02386:Utrn	APN	10	12421608	missense	possibly damaging	0.91
IGL02494:Utrn	APN	10	12710054	missense	probably benign
IGL02631:Utrn	APN	10	12710063	missense	probably benign	0.00
IGL02729:Utrn	APN	10	12720810	unclassified	probably benign
IGL02736:Utrn	APN	10	12421640	missense	probably damaging	1.00
IGL02832:Utrn	APN	10	12738193	missense	possibly damaging	0.82
IGL02926:Utrn	APN	10	12690760	missense	probably damaging	0.96
IGL03184:Utrn	APN	10	12710166	missense	probably benign	0.04
IGL03194:Utrn	APN	10	12406429	splice site	probably benign
IGL03346:Utrn	APN	10	12525352	missense	probably benign	0.22
retiring	UTSW	10	12641020	missense	probably damaging	1.00
shrinking_violet	UTSW	10	12711585	critical splice acceptor site	probably null
Wallflower	UTSW	10	12747975	missense	probably damaging	1.00
I2288:Utrn	UTSW	10	12421640	missense	probably damaging	1.00
PIT4677001:Utrn	UTSW	10	12666704	missense	probably benign	0.06
R0022:Utrn	UTSW	10	12709956	splice site	probably benign
R0024:Utrn	UTSW	10	12406011	missense	probably benign	0.00
R0024:Utrn	UTSW	10	12406011	missense	probably benign	0.00
R0026:Utrn	UTSW	10	12726196	splice site	probably benign
R0026:Utrn	UTSW	10	12726196	splice site	probably benign
R0091:Utrn	UTSW	10	12735204	missense	probably damaging	1.00
R0112:Utrn	UTSW	10	12686465	nonsense	probably null
R0126:Utrn	UTSW	10	12711475	missense	probably benign	0.02
R0184:Utrn	UTSW	10	12667618	missense	probably benign
R0219:Utrn	UTSW	10	12684451	missense	probably damaging	1.00
R0369:Utrn	UTSW	10	12634022	missense	probably benign	0.37
R0390:Utrn	UTSW	10	12710060	missense	probably benign	0.05
R0391:Utrn	UTSW	10	12525333	splice site	probably benign
R0408:Utrn	UTSW	10	12384190	makesense	probably null
R0409:Utrn	UTSW	10	12643601	missense	probably benign	0.01
R0441:Utrn	UTSW	10	12688294	missense	probably null	0.88
R0504:Utrn	UTSW	10	12402895	missense	probably benign	0.02
R0730:Utrn	UTSW	10	12698158	splice site	probably benign
R1078:Utrn	UTSW	10	12455566	critical splice acceptor site	probably null
R1171:Utrn	UTSW	10	12481308	missense	probably damaging	0.99
R1191:Utrn	UTSW	10	12634033	missense	probably benign	0.02
R1203:Utrn	UTSW	10	12486537	missense	probably damaging	1.00
R1401:Utrn	UTSW	10	12649153	missense	probably benign
R1418:Utrn	UTSW	10	12713350	missense	probably benign
R1439:Utrn	UTSW	10	12744049	missense	possibly damaging	0.79
R1441:Utrn	UTSW	10	12683295	missense	probably damaging	0.97
R1445:Utrn	UTSW	10	12678574	splice site	probably benign
R1509:Utrn	UTSW	10	12455441	missense	possibly damaging	0.91
R1546:Utrn	UTSW	10	12436364	missense	probably damaging	1.00
R1585:Utrn	UTSW	10	12436285	missense	possibly damaging	0.62
R1621:Utrn	UTSW	10	12713283	missense	probably benign	0.24
R1637:Utrn	UTSW	10	12436364	missense	probably damaging	1.00
R1703:Utrn	UTSW	10	12727729	splice site	probably benign
R1725:Utrn	UTSW	10	12663519	missense	probably damaging	0.99
R1735:Utrn	UTSW	10	12710138	missense	probably benign
R1770:Utrn	UTSW	10	12475296	missense	probably damaging	0.98
R1778:Utrn	UTSW	10	12436364	missense	probably damaging	1.00
R1783:Utrn	UTSW	10	12463339	missense	probably damaging	1.00
R1818:Utrn	UTSW	10	12709964	critical splice donor site	probably null
R1829:Utrn	UTSW	10	12475274	missense	probably damaging	1.00
R1919:Utrn	UTSW	10	12455480	missense	probably benign	0.15
R1964:Utrn	UTSW	10	12684437	missense	probably damaging	1.00
R2080:Utrn	UTSW	10	12737082	missense	probably benign	0.36
R2092:Utrn	UTSW	10	12678698	missense	probably benign	0.12
R2107:Utrn	UTSW	10	12436364	missense	probably damaging	1.00
R2108:Utrn	UTSW	10	12436364	missense	probably damaging	1.00
R2760:Utrn	UTSW	10	12690878	missense	probably damaging	1.00
R2884:Utrn	UTSW	10	12739361	splice site	probably null
R2885:Utrn	UTSW	10	12739361	splice site	probably null
R2886:Utrn	UTSW	10	12739361	splice site	probably null
R2903:Utrn	UTSW	10	12643428	missense	probably damaging	1.00
R2944:Utrn	UTSW	10	12643419	missense	probably damaging	1.00
R2945:Utrn	UTSW	10	12486391	missense	possibly damaging	0.50
R3438:Utrn	UTSW	10	12481318	missense	probably damaging	0.98
R3683:Utrn	UTSW	10	12666835	missense	probably benign	0.10
R3735:Utrn	UTSW	10	12478484	missense	probably damaging	1.00
R3907:Utrn	UTSW	10	12710182	splice site	probably benign
R3923:Utrn	UTSW	10	12739479	missense	probably benign	0.23
R3925:Utrn	UTSW	10	12698042	missense	probably benign
R3926:Utrn	UTSW	10	12698042	missense	probably benign
R3938:Utrn	UTSW	10	12750030	critical splice donor site	probably null
R3941:Utrn	UTSW	10	12711585	critical splice acceptor site	probably null
R3958:Utrn	UTSW	10	12750108	missense	probably damaging	1.00
R4091:Utrn	UTSW	10	12710171	missense	probably benign	0.10
R4454:Utrn	UTSW	10	12727840	missense	possibly damaging	0.81
R4585:Utrn	UTSW	10	12688306	missense	probably benign	0.01
R4667:Utrn	UTSW	10	12698053	missense	probably benign	0.22
R4684:Utrn	UTSW	10	12745240	missense	probably damaging	1.00
R4782:Utrn	UTSW	10	12750069	missense	probably damaging	1.00
R4785:Utrn	UTSW	10	12654745	missense	probably benign	0.39
R4799:Utrn	UTSW	10	12750069	missense	probably damaging	1.00
R4829:Utrn	UTSW	10	12663461	missense	probably benign	0.00
R4878:Utrn	UTSW	10	12727758	missense	probably damaging	1.00
R4955:Utrn	UTSW	10	12861567	critical splice donor site	probably null
R4967:Utrn	UTSW	10	12455420	missense	probably damaging	0.99
R5071:Utrn	UTSW	10	12384204	splice site	probably null
R5072:Utrn	UTSW	10	12384204	splice site	probably null
R5186:Utrn	UTSW	10	12728777	missense	probably damaging	1.00
R5213:Utrn	UTSW	10	12636760	missense	probably damaging	1.00
R5296:Utrn	UTSW	10	12401355	missense	probably damaging	1.00
R5309:Utrn	UTSW	10	12727769	missense	probably damaging	1.00
R5312:Utrn	UTSW	10	12727769	missense	probably damaging	1.00
R5399:Utrn	UTSW	10	12640983	missense	probably damaging	1.00
R5407:Utrn	UTSW	10	12680625	missense	probably damaging	1.00
R5411:Utrn	UTSW	10	12649185	missense	probably benign
R5428:Utrn	UTSW	10	12693431	missense	probably benign	0.09
R5595:Utrn	UTSW	10	12682318	missense	possibly damaging	0.89
R5602:Utrn	UTSW	10	12750095	missense	probably damaging	1.00
R5608:Utrn	UTSW	10	12671837	missense	probably benign	0.00
R5678:Utrn	UTSW	10	12442018	missense	probably damaging	1.00
R5726:Utrn	UTSW	10	12669806	missense	probably benign
R5804:Utrn	UTSW	10	12421625	missense	probably damaging	1.00
R5916:Utrn	UTSW	10	12665051	missense	probably damaging	0.97
R5941:Utrn	UTSW	10	12486483	missense	probably damaging	1.00
R6014:Utrn	UTSW	10	12690876	missense	probably benign	0.01
R6015:Utrn	UTSW	10	12478424	missense	possibly damaging	0.85
R6028:Utrn	UTSW	10	12654716	missense	probably benign	0.00
R6158:Utrn	UTSW	10	12690822	missense	probably benign	0.04
R6181:Utrn	UTSW	10	12739456	missense	probably damaging	1.00
R6300:Utrn	UTSW	10	12501476	missense	probably benign	0.35
R6367:Utrn	UTSW	10	12747975	missense	probably damaging	1.00
R6377:Utrn	UTSW	10	12744083	missense	probably damaging	1.00
R6434:Utrn	UTSW	10	12525427	missense	probably damaging	1.00
R6498:Utrn	UTSW	10	12442093	missense	probably benign
R6579:Utrn	UTSW	10	12748006	missense	probably benign	0.05
R6704:Utrn	UTSW	10	12745291	missense	probably damaging	0.99
R6736:Utrn	UTSW	10	12621303	missense	probably benign	0.09
R6755:Utrn	UTSW	10	12699087	missense	probably benign	0.00
R6793:Utrn	UTSW	10	12640925	critical splice donor site	probably null
R6793:Utrn	UTSW	10	12699100	missense	possibly damaging	0.69
R6835:Utrn	UTSW	10	12727764	missense	probably damaging	1.00
R6919:Utrn	UTSW	10	12693470	nonsense	probably null
R6920:Utrn	UTSW	10	12750470	missense	probably damaging	0.98
R7037:Utrn	UTSW	10	12826770	splice site	probably null
R7038:Utrn	UTSW	10	12682338	missense	probably damaging	1.00
R7055:Utrn	UTSW	10	12747921	missense	probably benign	0.23
R7072:Utrn	UTSW	10	12465213	missense	probably damaging	1.00
R7090:Utrn	UTSW	10	12684516	missense	possibly damaging	0.58
R7211:Utrn	UTSW	10	12401335	missense	possibly damaging	0.72
R7248:Utrn	UTSW	10	12728818	missense	possibly damaging	0.51
R7305:Utrn	UTSW	10	12385536	missense	probably benign
R7334:Utrn	UTSW	10	12728009	splice site	probably null
R7348:Utrn	UTSW	10	12748018	missense	probably damaging	1.00
R7375:Utrn	UTSW	10	12641020	missense	probably damaging	1.00
R7436:Utrn	UTSW	10	12439791	missense	possibly damaging	0.72
R7476:Utrn	UTSW	10	12640951	missense	probably benign
R7514:Utrn	UTSW	10	12698089	missense	probably benign	0.00
R7527:Utrn	UTSW	10	12401382	missense	possibly damaging	0.81
R7735:Utrn	UTSW	10	12744043	critical splice donor site	probably null
R7748:Utrn	UTSW	10	12614508	missense	probably benign	0.01
R7778:Utrn	UTSW	10	12486610	missense	probably damaging	1.00
R7824:Utrn	UTSW	10	12486610	missense	probably damaging	1.00
R7826:Utrn	UTSW	10	12401306	splice site	probably null
R7872:Utrn	UTSW	10	12698129	missense	probably benign
R7915:Utrn	UTSW	10	12465212	missense	probably damaging	1.00
R7922:Utrn	UTSW	10	12667527	missense	possibly damaging	0.68
R8081:Utrn	UTSW	10	12548059	start gained	probably benign
R8132:Utrn	UTSW	10	12682410	missense	probably damaging	0.99
R8167:Utrn	UTSW	10	12671814	nonsense	probably null
R8186:Utrn	UTSW	10	12698123	missense	probably benign
R8331:Utrn	UTSW	10	12614619	missense	probably benign	0.00
R8352:Utrn	UTSW	10	12813509	missense	probably benign	0.34
R8408:Utrn	UTSW	10	12670143	missense	possibly damaging	0.69
R8452:Utrn	UTSW	10	12813509	missense	probably benign	0.34
R8478:Utrn	UTSW	10	12649148	missense	probably benign
R8489:Utrn	UTSW	10	12711446	missense	probably benign	0.05
R8516:Utrn	UTSW	10	12486510	missense	probably damaging	0.99
R8520:Utrn	UTSW	10	12670186	nonsense	probably null
R8550:Utrn	UTSW	10	12813585	intron	probably benign
R8856:Utrn	UTSW	10	12667607	missense	probably benign
R8881:Utrn	UTSW	10	12547993	missense	possibly damaging	0.46
R9180:Utrn	UTSW	10	12669719	missense	probably damaging	1.00
R9186:Utrn	UTSW	10	12614574	missense	probably benign
R9216:Utrn	UTSW	10	12813485	missense	probably benign	0.19
R9251:Utrn	UTSW	10	12636787	missense	probably benign	0.01
R9273:Utrn	UTSW	10	12633963	missense	probably damaging	0.97
R9307:Utrn	UTSW	10	12678731	missense	probably benign	0.02
R9344:Utrn	UTSW	10	12684531	missense	probably benign	0.17
R9419:Utrn	UTSW	10	12688381	missense	probably damaging	1.00
R9435:Utrn	UTSW	10	12643429	missense	probably damaging	1.00
R9623:Utrn	UTSW	10	12406481	missense	probably damaging	1.00
R9650:Utrn	UTSW	10	12738185	missense	probably benign	0.00
R9653:Utrn	UTSW	10	12621379	missense	probably benign	0.17
R9653:Utrn	UTSW	10	12663445	missense	probably benign	0.41
R9672:Utrn	UTSW	10	12727869	missense	possibly damaging	0.68
R9678:Utrn	UTSW	10	12739415	missense	probably benign	0.00
R9741:Utrn	UTSW	10	12826820	missense	probably benign
R9765:Utrn	UTSW	10	12735177	missense	probably damaging	0.99
R9799:Utrn	UTSW	10	12709992	missense	probably benign	0.01
RF009:Utrn	UTSW	10	12633945	nonsense	probably null
V1662:Utrn	UTSW	10	12421640	missense	probably damaging	1.00
X0018:Utrn	UTSW	10	12735198	missense	probably damaging	1.00
Z1176:Utrn	UTSW	10	12682360	nonsense	probably null
Z1176:Utrn	UTSW	10	12688429	critical splice acceptor site	probably null
Z1177:Utrn	UTSW	10	12525406	nonsense	probably null
Z1177:Utrn	UTSW	10	12621379	missense	probably benign	0.17
Z1186:Utrn	UTSW	10	12669747	missense	probably damaging	1.00
Z1189:Utrn	UTSW	10	12669747	missense	probably damaging	1.00
Z1191:Utrn	UTSW	10	12669747	missense	probably damaging	1.00
Z1192:Utrn	UTSW	10	12669747	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTGCTCTCAGAGAACTACAAAATG -3'
(R):5'- AGTTACTGAGTGACCAGTTCTAAC -3'

Sequencing Primer
(F):5'- CACTCTGCACAAAATATACTGA -3'
(R):5'- ACTGTGTTTCAATTTACACCTTAGC -3'

Posted On

2018-04-05