Incidental Mutation 'R1589:Trappc8'
ID177770
Institutional Source Beutler Lab
Gene Symbol Trappc8
Ensembl Gene ENSMUSG00000033382
Gene Nametrafficking protein particle complex 8
SynonymsD030074E01Rik, Trs85, 5033403J15Rik
MMRRC Submission 039626-MU
Accession Numbers

Genbank: NM_029491; MGI: 2443008

Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R1589 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location20817223-20896093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20863551 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 436 (Y436H)
Ref Sequence ENSEMBL: ENSMUSP00000095262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025177] [ENSMUST00000097658] [ENSMUST00000224530] [ENSMUST00000225661]
Predicted Effect probably damaging
Transcript: ENSMUST00000025177
AA Change: Y436H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025177
Gene: ENSMUSG00000033382
AA Change: Y436H

DomainStartEndE-ValueType
Pfam:TRAPPC-Trs85 157 604 1e-167 PFAM
low complexity region 769 777 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097658
AA Change: Y436H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095262
Gene: ENSMUSG00000033382
AA Change: Y436H

DomainStartEndE-ValueType
Pfam:TRAPPC-Trs85 152 605 9.3e-135 PFAM
low complexity region 769 777 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224530
Predicted Effect probably damaging
Transcript: ENSMUST00000225661
AA Change: Y435H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.7022 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 97% (89/92)
Allele List at MGI

All alleles(11) : Gene trapped(11)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,441 probably benign Het
Aadacl2 C T 3: 60,010,576 T82I probably benign Het
Acadl T C 1: 66,853,223 N147S probably benign Het
Actr3 A T 1: 125,408,563 M79K probably damaging Het
Agbl3 A G 6: 34,857,517 S874G possibly damaging Het
Aoah A T 13: 21,002,948 T472S probably damaging Het
Asb16 A T 11: 102,268,995 D58V probably damaging Het
B4galt1 T C 4: 40,823,575 D172G probably benign Het
Bax T C 7: 45,465,247 N55S possibly damaging Het
Bdkrb2 A G 12: 105,591,859 N120D possibly damaging Het
Bicdl1 T C 5: 115,651,266 probably benign Het
Cand1 A G 10: 119,213,566 L425P probably damaging Het
Caskin1 G A 17: 24,505,478 probably null Het
Cd248 C T 19: 5,069,932 P603S probably benign Het
Cep95 G T 11: 106,800,104 R143L probably benign Het
Clptm1l G T 13: 73,614,673 probably null Het
Cntnap5a T C 1: 116,060,200 F154L possibly damaging Het
Cyld A T 8: 88,709,990 I303F possibly damaging Het
Dock2 A G 11: 34,706,461 S370P probably damaging Het
Enah G T 1: 181,922,293 T327K probably damaging Het
Farp2 A T 1: 93,579,860 S427C probably damaging Het
Fbxw11 C T 11: 32,733,612 T301M probably damaging Het
Foxc2 A T 8: 121,117,176 T188S probably benign Het
Fzd2 A G 11: 102,606,328 T533A probably benign Het
Glb1l2 G T 9: 26,769,038 S248* probably null Het
Glul A T 1: 153,905,538 probably benign Het
Gm28042 A G 2: 120,041,406 T946A probably benign Het
Golga3 T A 5: 110,181,783 D2E probably damaging Het
Grm1 A T 10: 10,719,967 F639Y probably benign Het
Gzmn A G 14: 56,165,911 L247P probably benign Het
Hgf T G 5: 16,613,785 I525R probably damaging Het
Hnrnpul2 T A 19: 8,831,332 D719E probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itga9 T C 9: 118,607,117 probably null Het
Itgb1 T A 8: 128,705,458 C16S probably damaging Het
Itgb1 G T 8: 128,705,459 C16F possibly damaging Het
Kat14 A G 2: 144,394,100 I251V probably benign Het
Kdsr A T 1: 106,734,541 probably null Het
Kif12 T A 4: 63,166,500 E527V probably benign Het
Larp1b T C 3: 41,033,474 S44P probably damaging Het
Lonp2 T C 8: 86,673,072 probably benign Het
Lrp1 C T 10: 127,605,606 S216N probably benign Het
Lrrc19 T C 4: 94,640,950 S32G probably benign Het
Mdm2 G A 10: 117,690,529 T335M probably benign Het
Mettl25 A G 10: 105,779,632 Y504H probably damaging Het
Mill1 T C 7: 18,245,647 I13T probably benign Het
Mmachc T A 4: 116,703,524 Q258L probably benign Het
Mpdz T A 4: 81,421,176 I5L probably benign Het
Mrps2 C T 2: 28,469,488 A119V probably benign Het
Mtmr11 A G 3: 96,168,113 T370A probably benign Het
Nmi T C 2: 51,958,977 I34V possibly damaging Het
Obscn A T 11: 59,036,075 M5538K possibly damaging Het
Ogdhl T C 14: 32,325,865 I24T probably benign Het
Olfr1477 C T 19: 13,502,757 T138M probably benign Het
Olfr675 A G 7: 105,024,560 V140A probably benign Het
Olfr703 A G 7: 106,845,196 Y195C possibly damaging Het
Olfr816 A G 10: 129,911,681 V199A probably benign Het
Omp G T 7: 98,145,359 D20E probably benign Het
Otog A G 7: 46,283,908 H1291R probably benign Het
Pgbd1 A G 13: 21,423,292 L244P probably damaging Het
Ranbp2 A G 10: 58,463,986 I481V probably benign Het
Rbp3 A T 14: 33,955,792 I566F probably damaging Het
Rsph4a A G 10: 33,905,529 D125G probably benign Het
Scn11a A G 9: 119,769,807 V1219A probably damaging Het
Serpine3 G A 14: 62,674,381 G264D probably benign Het
Slc4a10 T C 2: 62,257,462 F400L probably damaging Het
Slco1a4 C T 6: 141,845,447 V8I probably benign Het
Soga1 A T 2: 157,027,637 M1026K probably benign Het
Spen T C 4: 141,488,024 D499G unknown Het
Stk32c A G 7: 139,119,015 probably null Het
Tars A G 15: 11,388,175 V485A probably benign Het
Tcerg1l A G 7: 138,361,767 L258P probably damaging Het
Tmc2 A T 2: 130,247,960 I622F probably damaging Het
Tmem183a A T 1: 134,354,706 N220K probably damaging Het
Tnni3 T C 7: 4,520,526 D146G probably damaging Het
Trappc11 G T 8: 47,501,680 D908E probably damaging Het
Ttc41 G A 10: 86,776,390 V1176I probably benign Het
Ube2b A G 11: 51,997,872 V24A probably benign Het
Usp30 T C 5: 114,112,961 C233R probably damaging Het
Vmn1r87 T A 7: 13,131,776 T195S possibly damaging Het
Vmn2r24 T C 6: 123,806,520 probably benign Het
Vmn2r81 C A 10: 79,293,024 T583N probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wdr1 C A 5: 38,529,972 V239L probably benign Het
Wdr17 C T 8: 54,703,907 probably benign Het
Zfhx4 A C 3: 5,241,729 D5A probably damaging Het
Zfyve27 T C 19: 42,171,745 probably null Het
Other mutations in Trappc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Trappc8 APN 18 20836978 missense probably benign 0.20
IGL01367:Trappc8 APN 18 20866119 missense probably benign 0.01
IGL01537:Trappc8 APN 18 20835004 missense probably benign
IGL01563:Trappc8 APN 18 20837046 missense probably benign 0.00
IGL01982:Trappc8 APN 18 20874712 splice site probably benign
IGL02709:Trappc8 APN 18 20837178 missense possibly damaging 0.94
IGL03126:Trappc8 APN 18 20863595 missense probably damaging 1.00
IGL03290:Trappc8 APN 18 20820935 missense probably damaging 1.00
IGL03348:Trappc8 APN 18 20852781 missense probably damaging 1.00
hoppa UTSW 18 20836900 missense probably benign 0.05
Lagomorpha UTSW 18 20818190 missense probably benign 0.11
rabbit UTSW 18 20874680 missense probably damaging 1.00
E7848:Trappc8 UTSW 18 20850918 missense probably damaging 0.99
R0483:Trappc8 UTSW 18 20845601 missense possibly damaging 0.60
R0492:Trappc8 UTSW 18 20866186 missense probably benign 0.07
R0506:Trappc8 UTSW 18 20844188 missense possibly damaging 0.49
R0610:Trappc8 UTSW 18 20837188 missense probably damaging 1.00
R0892:Trappc8 UTSW 18 20831608 critical splice donor site probably null
R1561:Trappc8 UTSW 18 20841623 nonsense probably null
R1700:Trappc8 UTSW 18 20832998 missense probably damaging 1.00
R1785:Trappc8 UTSW 18 20834940 splice site probably null
R1786:Trappc8 UTSW 18 20834940 splice site probably null
R1989:Trappc8 UTSW 18 20845651 missense probably benign 0.04
R2181:Trappc8 UTSW 18 20819222 critical splice donor site probably null
R2294:Trappc8 UTSW 18 20866154 nonsense probably null
R4551:Trappc8 UTSW 18 20874672 missense probably benign 0.10
R4594:Trappc8 UTSW 18 20836948 missense probably benign
R4631:Trappc8 UTSW 18 20867808 missense probably benign 0.22
R4734:Trappc8 UTSW 18 20841572 nonsense probably null
R4834:Trappc8 UTSW 18 20825065 missense probably damaging 0.99
R5114:Trappc8 UTSW 18 20844180 missense probably benign 0.04
R5262:Trappc8 UTSW 18 20818190 missense probably benign 0.11
R5384:Trappc8 UTSW 18 20833062 intron probably null
R5476:Trappc8 UTSW 18 20865108 missense probably damaging 1.00
R5503:Trappc8 UTSW 18 20836900 missense probably benign 0.05
R5577:Trappc8 UTSW 18 20836779 nonsense probably null
R5809:Trappc8 UTSW 18 20818082 missense probably benign 0.08
R5825:Trappc8 UTSW 18 20873920 missense probably damaging 1.00
R5886:Trappc8 UTSW 18 20874680 missense probably damaging 1.00
R5936:Trappc8 UTSW 18 20874688 missense probably damaging 1.00
R6024:Trappc8 UTSW 18 20833009 missense probably damaging 0.98
R6105:Trappc8 UTSW 18 20846447 critical splice donor site probably null
R6229:Trappc8 UTSW 18 20870745 missense probably benign 0.00
R6376:Trappc8 UTSW 18 20837075 missense probably benign 0.07
R6403:Trappc8 UTSW 18 20866071 missense probably benign
R6459:Trappc8 UTSW 18 20836868 missense probably benign 0.40
R6673:Trappc8 UTSW 18 20885257 missense probably benign 0.01
R7041:Trappc8 UTSW 18 20874672 missense probably benign 0.10
R7276:Trappc8 UTSW 18 20818091 missense probably damaging 0.99
R7341:Trappc8 UTSW 18 20852647 missense probably damaging 1.00
R7684:Trappc8 UTSW 18 20863502 missense probably benign 0.01
R7702:Trappc8 UTSW 18 20825062 missense probably damaging 0.99
X0065:Trappc8 UTSW 18 20860522 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCTGACACTGCTGCCATTTCCTAAAG -3'
(R):5'- TGTTCTGGGTAGTTGAACAACTTCCTG -3'

Sequencing Primer
(F):5'- tgggaggtggaggcagg -3'
(R):5'- CAACTTCCTGTATTTTATATGTGCTG -3'
Posted On2014-04-24