Incidental Mutation 'R6405:Zcchc7'
ID516246
Institutional Source Beutler Lab
Gene Symbol Zcchc7
Ensembl Gene ENSMUSG00000035649
Gene Namezinc finger, CCHC domain containing 7
SynonymsD4Wsu132e, 4930572I07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R6405 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location44755877-44932215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44926032 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 344 (Y344H)
Ref Sequence ENSEMBL: ENSMUSP00000103454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107824] [ENSMUST00000147272]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107823
Predicted Effect probably damaging
Transcript: ENSMUST00000107824
AA Change: Y344H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103454
Gene: ENSMUSG00000035649
AA Change: Y344H

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
ZnF_C2HC 237 253 4.13e-3 SMART
ZnF_C2HC 259 275 1.51e0 SMART
ZnF_C2HC 300 316 1.08e0 SMART
low complexity region 324 336 N/A INTRINSIC
ZnF_C2HC 344 360 9.16e-2 SMART
low complexity region 497 517 N/A INTRINSIC
low complexity region 530 538 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000126968
AA Change: Y13H
SMART Domains Protein: ENSMUSP00000125979
Gene: ENSMUSG00000035649
AA Change: Y13H

DomainStartEndE-ValueType
ZnF_C2HC 14 30 9.16e-2 SMART
low complexity region 52 68 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000147272
AA Change: Y23H

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126678
Gene: ENSMUSG00000035649
AA Change: Y23H

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
ZnF_C2HC 23 39 9.16e-2 SMART
low complexity region 176 196 N/A INTRINSIC
low complexity region 209 217 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,878 V769A probably damaging Het
Abca4 A G 3: 122,173,662 probably null Het
Ahnak2 A T 12: 112,773,337 S628T probably damaging Het
Ano8 T C 8: 71,483,030 T315A probably damaging Het
Arhgap32 T A 9: 32,248,488 V267E probably benign Het
Asnsd1 A T 1: 53,347,995 S158T probably damaging Het
Asxl2 T A 12: 3,493,758 V309E probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ccdc110 T A 8: 45,941,697 Y208* probably null Het
Cfap157 G T 2: 32,781,396 Q133K probably damaging Het
Cfap53 A G 18: 74,359,606 E467G probably damaging Het
Csmd3 T C 15: 47,820,371 I1688M probably damaging Het
Cyp3a11 A T 5: 145,862,420 L319Q probably damaging Het
Dchs2 A G 3: 83,354,263 I2613V probably benign Het
Dhx35 T A 2: 158,794,919 W11R probably damaging Het
Dscam C T 16: 96,678,425 G1174D probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Greb1l T A 18: 10,501,076 I402K probably benign Het
Hectd3 A T 4: 117,000,624 M585L probably benign Het
Inpp5k T C 11: 75,633,178 probably null Het
Lalba T G 15: 98,480,751 probably null Het
Lgals9 C A 11: 78,971,385 V125L probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr117 A G 17: 37,660,123 I70T possibly damaging Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Rab4b T A 7: 27,172,954 D94V probably damaging Het
Rhpn2 A G 7: 35,372,439 E243G probably benign Het
Rp1 T C 1: 4,345,771 D1706G probably damaging Het
Slc29a3 A T 10: 60,716,026 I413N probably damaging Het
Slc7a9 T C 7: 35,454,639 L229P probably damaging Het
Tenm2 T C 11: 36,864,859 H104R probably benign Het
Tmem87a A G 2: 120,379,750 Y241H probably damaging Het
Trpv5 G T 6: 41,674,668 T192K probably damaging Het
Unc79 T C 12: 103,168,336 V2189A probably damaging Het
Vmn2r106 A C 17: 20,279,099 S183R probably benign Het
Vmn2r112 G T 17: 22,618,235 C559F probably damaging Het
Wdhd1 T C 14: 47,243,867 D1031G possibly damaging Het
Wnt5b T C 6: 119,433,496 S328G probably benign Het
Other mutations in Zcchc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Zcchc7 APN 4 44931318 missense possibly damaging 0.76
IGL00542:Zcchc7 APN 4 44931462 missense probably benign 0.00
IGL01309:Zcchc7 APN 4 44926060 missense probably damaging 1.00
IGL01753:Zcchc7 APN 4 44929217 missense probably benign 0.30
IGL02186:Zcchc7 APN 4 44762250 missense possibly damaging 0.95
IGL02395:Zcchc7 APN 4 44761868 utr 5 prime probably benign
IGL02423:Zcchc7 APN 4 44931244 missense possibly damaging 0.81
IGL03350:Zcchc7 APN 4 44931188 missense probably benign 0.13
R0371:Zcchc7 UTSW 4 44762190 missense probably damaging 1.00
R1449:Zcchc7 UTSW 4 44929124 missense possibly damaging 0.66
R2061:Zcchc7 UTSW 4 44895838 missense probably damaging 1.00
R2096:Zcchc7 UTSW 4 44931059 missense probably damaging 0.98
R4274:Zcchc7 UTSW 4 44931335 missense possibly damaging 0.87
R4668:Zcchc7 UTSW 4 44895964 missense probably damaging 1.00
R4989:Zcchc7 UTSW 4 44931039 missense probably damaging 1.00
R5340:Zcchc7 UTSW 4 44762245 missense probably benign 0.04
R5397:Zcchc7 UTSW 4 44926048 missense probably damaging 0.96
R5700:Zcchc7 UTSW 4 44931084 missense probably benign 0.00
R5891:Zcchc7 UTSW 4 44895838 missense probably damaging 1.00
R5950:Zcchc7 UTSW 4 44931244 missense possibly damaging 0.81
R5977:Zcchc7 UTSW 4 44894982 missense possibly damaging 0.77
R6005:Zcchc7 UTSW 4 44931218 frame shift probably null
R7787:Zcchc7 UTSW 4 44895043 critical splice donor site probably null
R8178:Zcchc7 UTSW 4 44931398 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATGTTGTTTCCTGGGCTC -3'
(R):5'- TGCCTCACTACCTTTAGGAGC -3'

Sequencing Primer
(F):5'- GTTTCCTGGGCTCTATCATGAG -3'
(R):5'- CTCACTACCTTTAGGAGCTAAATTTG -3'
Posted On2018-05-04