Incidental Mutation 'R6462:Ctdp1'
ID 517658
Institutional Source Beutler Lab
Gene Symbol Ctdp1
Ensembl Gene ENSMUSG00000033323
Gene Name CTD phosphatase subunit 1
Synonyms 4930563P03Rik
MMRRC Submission 044596-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.922) question?
Stock # R6462 (G1)
Quality Score 215.009
Status Validated
Chromosome 18
Chromosomal Location 80451174-80512910 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 80463689 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 116 (E116K)
Ref Sequence ENSEMBL: ENSMUSP00000123705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036229] [ENSMUST00000161003]
AlphaFold Q7TSG2
Predicted Effect possibly damaging
Transcript: ENSMUST00000036229
AA Change: E904K

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038938
Gene: ENSMUSG00000033323
AA Change: E904K

DomainStartEndE-ValueType
low complexity region 55 72 N/A INTRINSIC
CPDc 181 327 1.21e-62 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 568 587 N/A INTRINSIC
BRCT 621 708 9.62e-7 SMART
low complexity region 779 787 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
PDB:1ONV|B 890 921 2e-6 PDB
coiled coil region 936 959 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160434
Predicted Effect probably damaging
Transcript: ENSMUST00000161003
AA Change: E116K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123705
Gene: ENSMUSG00000033323
AA Change: E116K

DomainStartEndE-ValueType
Pfam:FCP1_C 3 172 3.8e-92 PFAM
Meta Mutation Damage Score 0.1665 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.6%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with the carboxy-terminus of the RAP74 subunit of transcription initiation factor TFIIF, and functions as a phosphatase that processively dephosphorylates the C-terminus of POLR2A (a subunit of RNA polymerase II), making it available for initiation of gene expression. Mutations in this gene are associated with congenital cataracts, facial dysmorphism and neuropathy syndrome (CCFDN). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arpc1a C T 5: 145,045,197 (GRCm39) S362F probably benign Het
Brd9 C T 13: 74,088,788 (GRCm39) A171V probably damaging Het
Camta1 A G 4: 151,170,621 (GRCm39) V62A probably damaging Het
Cdc5l G A 17: 45,703,975 (GRCm39) R750C probably benign Het
Dync2i1 T C 12: 116,193,251 (GRCm39) N567S probably benign Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Epor T C 9: 21,870,551 (GRCm39) E443G probably benign Het
Fam90a1a A T 8: 22,449,298 (GRCm39) Q14L probably benign Het
Herc4 T C 10: 63,124,880 (GRCm39) L498P probably benign Het
Kif1b T C 4: 149,277,053 (GRCm39) M1337V probably benign Het
Lmod2 T G 6: 24,604,300 (GRCm39) V425G probably benign Het
Ly6c1 T A 15: 74,916,178 (GRCm39) probably benign Het
Me2 C A 18: 73,908,470 (GRCm39) V490F probably benign Het
Mllt3 T C 4: 87,692,338 (GRCm39) T27A probably damaging Het
Mmp1a T C 9: 7,467,039 (GRCm39) Y239H probably benign Het
Mycbp2 A G 14: 103,373,993 (GRCm39) probably null Het
Myo15b A C 11: 115,750,268 (GRCm39) E346A probably benign Het
Myo3a T C 2: 22,448,423 (GRCm39) F66S probably damaging Het
Ncor2 T C 5: 125,101,236 (GRCm39) Y137C probably damaging Het
Nup98 A T 7: 101,844,223 (GRCm39) F37L probably benign Het
Odf2l T G 3: 144,852,672 (GRCm39) L472R probably damaging Het
Or10al2 T C 17: 37,983,111 (GRCm39) Y66H probably damaging Het
P4ha3 T A 7: 99,963,873 (GRCm39) I463N probably damaging Het
Pappa C A 4: 65,043,128 (GRCm39) T117K probably damaging Het
Ppme1 C A 7: 99,987,599 (GRCm39) R271M probably benign Het
Rps6ka4 T G 19: 6,814,957 (GRCm39) E249A possibly damaging Het
Rxfp1 T A 3: 79,555,596 (GRCm39) I587F probably benign Het
Sipa1l2 A G 8: 126,217,969 (GRCm39) V456A probably damaging Het
Slc25a23 T A 17: 57,359,720 (GRCm39) I344F probably damaging Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Tbc1d10c T C 19: 4,234,893 (GRCm39) I389M possibly damaging Het
Tep1 A G 14: 51,081,836 (GRCm39) F1205L probably benign Het
Tgfbr1 T A 4: 47,402,846 (GRCm39) H214Q probably damaging Het
Traf3ip2 T A 10: 39,515,243 (GRCm39) N340K probably benign Het
Zbbx T C 3: 74,985,966 (GRCm39) E362G probably benign Het
Zfp46 A C 4: 136,017,924 (GRCm39) T253P probably damaging Het
Other mutations in Ctdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Ctdp1 APN 18 80,501,907 (GRCm39) splice site probably null
IGL01695:Ctdp1 APN 18 80,492,841 (GRCm39) missense probably damaging 1.00
IGL01865:Ctdp1 APN 18 80,499,199 (GRCm39) missense probably damaging 1.00
IGL02009:Ctdp1 APN 18 80,499,187 (GRCm39) missense probably damaging 1.00
IGL02419:Ctdp1 APN 18 80,463,799 (GRCm39) missense probably damaging 1.00
IGL02580:Ctdp1 APN 18 80,493,305 (GRCm39) missense probably benign 0.01
IGL02699:Ctdp1 APN 18 80,493,400 (GRCm39) missense probably benign
IGL03117:Ctdp1 APN 18 80,492,716 (GRCm39) missense probably damaging 0.98
IGL03301:Ctdp1 APN 18 80,492,849 (GRCm39) nonsense probably null
IGL03385:Ctdp1 APN 18 80,493,133 (GRCm39) missense probably damaging 1.00
R0370:Ctdp1 UTSW 18 80,492,569 (GRCm39) missense probably damaging 1.00
R0374:Ctdp1 UTSW 18 80,490,637 (GRCm39) critical splice donor site probably null
R0730:Ctdp1 UTSW 18 80,493,457 (GRCm39) missense probably benign 0.00
R0894:Ctdp1 UTSW 18 80,512,736 (GRCm39) missense probably benign 0.09
R1187:Ctdp1 UTSW 18 80,492,702 (GRCm39) missense probably damaging 1.00
R1437:Ctdp1 UTSW 18 80,493,428 (GRCm39) missense probably benign 0.01
R1988:Ctdp1 UTSW 18 80,492,616 (GRCm39) missense possibly damaging 0.89
R2192:Ctdp1 UTSW 18 80,492,696 (GRCm39) missense probably benign 0.30
R3709:Ctdp1 UTSW 18 80,493,428 (GRCm39) nonsense probably null
R3724:Ctdp1 UTSW 18 80,502,482 (GRCm39) missense probably benign 0.16
R3756:Ctdp1 UTSW 18 80,495,566 (GRCm39) missense probably damaging 0.98
R4297:Ctdp1 UTSW 18 80,493,172 (GRCm39) missense probably benign
R4298:Ctdp1 UTSW 18 80,493,172 (GRCm39) missense probably benign
R4640:Ctdp1 UTSW 18 80,494,369 (GRCm39) critical splice donor site probably null
R4841:Ctdp1 UTSW 18 80,451,941 (GRCm39) missense unknown
R4842:Ctdp1 UTSW 18 80,451,941 (GRCm39) missense unknown
R5007:Ctdp1 UTSW 18 80,463,695 (GRCm39) missense probably damaging 0.99
R5055:Ctdp1 UTSW 18 80,499,303 (GRCm39) missense probably damaging 1.00
R5219:Ctdp1 UTSW 18 80,490,675 (GRCm39) missense probably damaging 1.00
R5870:Ctdp1 UTSW 18 80,451,901 (GRCm39) missense unknown
R5896:Ctdp1 UTSW 18 80,502,003 (GRCm39) missense probably damaging 1.00
R6242:Ctdp1 UTSW 18 80,502,427 (GRCm39) missense probably damaging 1.00
R6255:Ctdp1 UTSW 18 80,502,512 (GRCm39) critical splice acceptor site probably null
R6300:Ctdp1 UTSW 18 80,502,455 (GRCm39) missense probably benign 0.26
R6431:Ctdp1 UTSW 18 80,494,470 (GRCm39) missense probably damaging 0.96
R6512:Ctdp1 UTSW 18 80,494,478 (GRCm39) missense probably damaging 1.00
R6537:Ctdp1 UTSW 18 80,492,766 (GRCm39) missense probably benign
R6802:Ctdp1 UTSW 18 80,463,656 (GRCm39) critical splice donor site probably null
R7477:Ctdp1 UTSW 18 80,483,929 (GRCm39) splice site probably null
R8121:Ctdp1 UTSW 18 80,499,223 (GRCm39) missense probably damaging 1.00
R8348:Ctdp1 UTSW 18 80,493,325 (GRCm39) missense probably benign 0.00
R8350:Ctdp1 UTSW 18 80,512,494 (GRCm39) missense probably benign 0.03
R8513:Ctdp1 UTSW 18 80,492,678 (GRCm39) missense possibly damaging 0.49
R9140:Ctdp1 UTSW 18 80,484,043 (GRCm39) critical splice donor site probably null
R9339:Ctdp1 UTSW 18 80,492,689 (GRCm39) missense probably damaging 1.00
R9617:Ctdp1 UTSW 18 80,492,962 (GRCm39) missense probably benign
R9758:Ctdp1 UTSW 18 80,492,710 (GRCm39) missense probably damaging 1.00
R9762:Ctdp1 UTSW 18 80,492,550 (GRCm39) nonsense probably null
X0020:Ctdp1 UTSW 18 80,493,205 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGTTAGAACCTAGTTCCCGTG -3'
(R):5'- ACTTGCCAGACAACCCTCTG -3'

Sequencing Primer
(F):5'- ATGTCTAACAGTCTGACAGTGCCG -3'
(R):5'- GACTCTCCACCTTTTGTCAGG -3'
Posted On 2018-05-21