Incidental Mutation 'R6462:Zbbx'
ID517625
Institutional Source Beutler Lab
Gene Symbol Zbbx
Ensembl Gene ENSMUSG00000034151
Gene Namezinc finger, B-box domain containing
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6462 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location75037907-75165034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75078659 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 362 (E362G)
Ref Sequence ENSEMBL: ENSMUSP00000103407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039269] [ENSMUST00000107775] [ENSMUST00000107776] [ENSMUST00000107778]
Predicted Effect probably benign
Transcript: ENSMUST00000039269
AA Change: E357G

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000043970
Gene: ENSMUSG00000034151
AA Change: E357G

DomainStartEndE-ValueType
Blast:BBOX 13 58 5e-22 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000107775
AA Change: S364G
SMART Domains Protein: ENSMUSP00000103404
Gene: ENSMUSG00000034151
AA Change: S364G

DomainStartEndE-ValueType
Pfam:zf-B_box 12 58 3.9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107776
AA Change: E357G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000103405
Gene: ENSMUSG00000034151
AA Change: E357G

DomainStartEndE-ValueType
Blast:BBOX 13 58 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107778
AA Change: E362G

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000103407
Gene: ENSMUSG00000034151
AA Change: E362G

DomainStartEndE-ValueType
Blast:BBOX 13 58 5e-22 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.6%
Validation Efficiency 95% (37/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arpc1a C T 5: 145,108,387 S362F probably benign Het
Brd9 C T 13: 73,940,669 A171V probably damaging Het
Camta1 A G 4: 151,086,164 V62A probably damaging Het
Cdc5l G A 17: 45,393,049 R750C probably benign Het
Ctdp1 C T 18: 80,420,474 E116K probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epor T C 9: 21,959,255 E443G probably benign Het
Fam90a1a A T 8: 21,959,282 Q14L probably benign Het
Herc4 T C 10: 63,289,101 L498P probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lmod2 T G 6: 24,604,301 V425G probably benign Het
Ly6c1 T A 15: 75,044,329 probably benign Het
Me2 C A 18: 73,775,399 V490F probably benign Het
Mllt3 T C 4: 87,774,101 T27A probably damaging Het
Mmp1a T C 9: 7,467,038 Y239H probably benign Het
Mycbp2 A G 14: 103,136,557 probably null Het
Myo15b A C 11: 115,859,442 E346A probably benign Het
Myo3a T C 2: 22,558,411 F66S probably damaging Het
Ncor2 T C 5: 125,024,172 Y137C probably damaging Het
Nup98 A T 7: 102,195,016 F37L probably benign Het
Odf2l T G 3: 145,146,911 L472R probably damaging Het
Olfr118 T C 17: 37,672,220 Y66H probably damaging Het
P4ha3 T A 7: 100,314,666 I463N probably damaging Het
Pappa C A 4: 65,124,891 T117K probably damaging Het
Ppme1 C A 7: 100,338,392 R271M probably benign Het
Rps6ka4 T G 19: 6,837,589 E249A possibly damaging Het
Rxfp1 T A 3: 79,648,289 I587F probably benign Het
Sipa1l2 A G 8: 125,491,230 V456A probably damaging Het
Slc25a23 T A 17: 57,052,720 I344F probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tbc1d10c T C 19: 4,184,894 I389M possibly damaging Het
Tep1 A G 14: 50,844,379 F1205L probably benign Het
Tgfbr1 T A 4: 47,402,846 H214Q probably damaging Het
Traf3ip2 T A 10: 39,639,247 N340K probably benign Het
Wdr60 T C 12: 116,229,631 N567S probably benign Het
Zfp46 A C 4: 136,290,613 T253P probably damaging Het
Other mutations in Zbbx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Zbbx APN 3 75061532 critical splice donor site probably null
IGL01328:Zbbx APN 3 75093075 nonsense probably null
IGL01340:Zbbx APN 3 75105650 missense possibly damaging 0.53
IGL01631:Zbbx APN 3 75078677 missense probably damaging 0.99
IGL01681:Zbbx APN 3 75052478 missense probably damaging 1.00
IGL02427:Zbbx APN 3 75139598 missense probably benign 0.04
IGL03077:Zbbx APN 3 75081846 missense possibly damaging 0.61
IGL03115:Zbbx APN 3 75078560 missense probably benign 0.03
IGL03162:Zbbx APN 3 75071623 splice site probably benign
Eland UTSW 3 75071712 missense probably benign 0.01
PIT4480001:Zbbx UTSW 3 75136487 missense probably damaging 1.00
PIT4495001:Zbbx UTSW 3 75061637 missense probably damaging 1.00
R0179:Zbbx UTSW 3 75085562 splice site probably benign
R0396:Zbbx UTSW 3 75078495 missense possibly damaging 0.81
R0523:Zbbx UTSW 3 75081858 missense probably benign 0.03
R0603:Zbbx UTSW 3 75078450 missense probably benign 0.05
R0745:Zbbx UTSW 3 75155427 missense probably damaging 1.00
R0747:Zbbx UTSW 3 75155427 missense probably damaging 1.00
R1208:Zbbx UTSW 3 75037992 missense possibly damaging 0.94
R1208:Zbbx UTSW 3 75037992 missense possibly damaging 0.94
R1371:Zbbx UTSW 3 75052477 missense possibly damaging 0.58
R1769:Zbbx UTSW 3 75083619 splice site probably benign
R1906:Zbbx UTSW 3 75071740 missense probably damaging 1.00
R2069:Zbbx UTSW 3 75078412 missense probably benign 0.01
R2165:Zbbx UTSW 3 75112107 missense probably damaging 0.99
R2174:Zbbx UTSW 3 75052414 missense possibly damaging 0.93
R2979:Zbbx UTSW 3 75078486 nonsense probably null
R3121:Zbbx UTSW 3 75081846 missense possibly damaging 0.88
R3755:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R3756:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R3816:Zbbx UTSW 3 75085495 missense probably benign 0.00
R4002:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4003:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4057:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4072:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4073:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4075:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4114:Zbbx UTSW 3 75139598 missense probably benign 0.04
R4784:Zbbx UTSW 3 75085041 missense probably benign 0.05
R4821:Zbbx UTSW 3 75081747 missense possibly damaging 0.68
R5008:Zbbx UTSW 3 75151448 missense possibly damaging 0.62
R5030:Zbbx UTSW 3 75083683 missense possibly damaging 0.83
R5388:Zbbx UTSW 3 75083670 missense probably damaging 0.98
R6398:Zbbx UTSW 3 75078565 missense probably damaging 0.96
R6597:Zbbx UTSW 3 75136454 missense probably damaging 1.00
R6882:Zbbx UTSW 3 75071712 missense probably benign 0.01
R7084:Zbbx UTSW 3 75139546 missense possibly damaging 0.92
R7096:Zbbx UTSW 3 75081737 missense probably benign 0.03
R7102:Zbbx UTSW 3 75112094 missense probably benign 0.06
R7256:Zbbx UTSW 3 75039898 missense probably benign 0.02
R7537:Zbbx UTSW 3 75085519 missense probably damaging 1.00
R7836:Zbbx UTSW 3 75078474 missense possibly damaging 0.65
R7905:Zbbx UTSW 3 75085513 missense probably benign 0.23
R7919:Zbbx UTSW 3 75078474 missense possibly damaging 0.65
R7988:Zbbx UTSW 3 75085513 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TACCAGTGGTTCCTTTGCAG -3'
(R):5'- CTGCCCCATTGTTGCTACAG -3'

Sequencing Primer
(F):5'- AAGTTTGACCTCTCATTTTGATTGC -3'
(R):5'- GCCCTGTCTTAACACAAATTTGAAC -3'
Posted On2018-05-21