Incidental Mutation 'R6464:Dsg3'
ID517755
Institutional Source Beutler Lab
Gene Symbol Dsg3
Ensembl Gene ENSMUSG00000056632
Gene Namedesmoglein 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.454) question?
Stock #R6464 (G1)
Quality Score187.009
Status Validated
Chromosome18
Chromosomal Location20510304-20541310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 20533526 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 597 (R597S)
Ref Sequence ENSEMBL: ENSMUSP00000064718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070892]
Predicted Effect probably benign
Transcript: ENSMUST00000070892
AA Change: R597S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000064718
Gene: ENSMUSG00000056632
AA Change: R597S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.9e-13 SMART
CA 179 265 2.36e-21 SMART
CA 288 382 1.55e-7 SMART
CA 409 493 6.15e-11 SMART
low complexity region 615 638 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
low complexity region 725 736 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein exhibit loss of keratinocyte cell adhesion resulting in a phenotype that resembles that of patients with pemphigus vulgaris. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutants display runting from decreased food intake due to oropharyngeal epithelial lesions, blisters around snout and eyes, hair loss by weaning, and hair regrowth with bald patches throughout life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,447,490 S769T probably damaging Het
Apoe G A 7: 19,697,536 T52M probably damaging Het
Arhgef10l A C 4: 140,586,815 M230R probably benign Het
Cdkl4 A T 17: 80,525,352 I321N probably benign Het
Ceacam5 T C 7: 17,747,466 probably null Het
Cfap70 T C 14: 20,401,039 probably null Het
Clasp2 A G 9: 113,773,717 Y195C probably damaging Het
Clip2 T C 5: 134,491,925 I999V probably benign Het
Cntnap5a A G 1: 116,184,408 D476G probably benign Het
Col6a6 C T 9: 105,788,953 M1I probably null Het
Cyp27a1 T C 1: 74,735,888 V292A possibly damaging Het
Cyp2c29 A G 19: 39,329,225 Y385C probably damaging Het
Fam131c T C 4: 141,382,342 I95T probably damaging Het
Fam13b A T 18: 34,473,631 C302* probably null Het
Fkbp15 T C 4: 62,308,078 K745E possibly damaging Het
Flg T A 3: 93,281,381 probably benign Het
Gm11559 T C 11: 99,864,716 C64R unknown Het
Gm14025 T C 2: 129,039,545 T154A possibly damaging Het
Gm35339 A G 15: 76,362,777 T1413A probably benign Het
Helt T C 8: 46,292,534 D104G probably damaging Het
Helz2 T C 2: 181,235,069 T1211A probably benign Het
Ifna9 T C 4: 88,592,250 R46G possibly damaging Het
Kif20b G A 19: 34,934,441 V235I probably benign Het
Kif7 A G 7: 79,714,094 V22A possibly damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lipf A T 19: 33,973,544 Y305F probably benign Het
Lpar1 A G 4: 58,486,875 L132P possibly damaging Het
Magi1 A T 6: 93,699,789 V834E probably damaging Het
Meltf T C 16: 31,890,776 Y432H probably benign Het
Mroh2a G C 1: 88,257,802 E1510D probably damaging Het
Myo1f T C 17: 33,576,647 L59P probably damaging Het
Naa25 G A 5: 121,417,961 D271N probably damaging Het
Olfr1038-ps A T 2: 86,122,408 I162F possibly damaging Het
Olfr1117-ps1 A T 2: 87,309,607 I273F probably damaging Het
Otoa A G 7: 121,102,605 Q169R probably damaging Het
Pde4dip C T 3: 97,710,344 D1723N probably damaging Het
Ptdss2 T C 7: 141,152,211 V175A probably damaging Het
Rdh8 G T 9: 20,823,400 R121L probably damaging Het
Rpl23 T C 11: 97,778,285 probably null Het
Scn5a T C 9: 119,534,580 D498G probably damaging Het
Slc39a14 G C 14: 70,306,728 L470V probably damaging Het
Smok2a C T 17: 13,226,430 A298V probably damaging Het
Tesk2 A C 4: 116,802,849 D388A probably damaging Het
Tnik G A 3: 28,611,970 probably null Het
Ube3a T A 7: 59,276,183 Y236* probably null Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn1r74 A T 7: 11,847,204 I144L possibly damaging Het
Vmn2r1 G A 3: 64,101,345 D482N probably benign Het
Vwf T C 6: 125,639,400 probably null Het
Zfp703 C G 8: 26,979,327 P340A probably damaging Het
Znfx1 T C 2: 167,046,922 S789G probably benign Het
Other mutations in Dsg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Dsg3 APN 18 20539654 missense probably damaging 1.00
IGL00697:Dsg3 APN 18 20524689 critical splice donor site probably null
IGL00966:Dsg3 APN 18 20523607 missense probably benign 0.02
IGL01352:Dsg3 APN 18 20523696 missense probably benign 0.25
IGL01953:Dsg3 APN 18 20525304 missense probably damaging 1.00
IGL02385:Dsg3 APN 18 20527714 missense probably damaging 1.00
IGL02622:Dsg3 APN 18 20528947 splice site probably benign
IGL02643:Dsg3 APN 18 20528955 missense probably benign 0.00
IGL02740:Dsg3 APN 18 20527708 missense possibly damaging 0.93
IGL03012:Dsg3 APN 18 20537243 critical splice acceptor site probably null
IGL03026:Dsg3 APN 18 20536972 splice site probably null
IGL03063:Dsg3 APN 18 20533368 splice site probably benign
IGL03098:Dsg3 APN 18 20510365 utr 5 prime probably benign
IGL03132:Dsg3 APN 18 20524596 missense probably damaging 1.00
IGL03352:Dsg3 APN 18 20527632 missense probably benign
P0035:Dsg3 UTSW 18 20539969 missense probably benign 0.05
R0039:Dsg3 UTSW 18 20521484 missense probably benign 0.36
R0099:Dsg3 UTSW 18 20540022 missense probably benign 0.01
R0109:Dsg3 UTSW 18 20540134 missense probably damaging 0.96
R0109:Dsg3 UTSW 18 20540134 missense probably damaging 0.96
R0143:Dsg3 UTSW 18 20536825 missense probably damaging 1.00
R0194:Dsg3 UTSW 18 20540142 missense probably damaging 1.00
R0373:Dsg3 UTSW 18 20539747 missense probably damaging 1.00
R0517:Dsg3 UTSW 18 20529025 missense probably benign 0.06
R0521:Dsg3 UTSW 18 20527815 missense possibly damaging 0.53
R1194:Dsg3 UTSW 18 20525220 missense probably damaging 0.98
R1551:Dsg3 UTSW 18 20536918 missense possibly damaging 0.84
R1762:Dsg3 UTSW 18 20539732 missense probably damaging 1.00
R1957:Dsg3 UTSW 18 20522105 missense probably damaging 1.00
R2061:Dsg3 UTSW 18 20527737 nonsense probably null
R2071:Dsg3 UTSW 18 20536825 missense probably damaging 1.00
R2513:Dsg3 UTSW 18 20523662 missense possibly damaging 0.48
R2571:Dsg3 UTSW 18 20540005 missense probably benign 0.01
R2945:Dsg3 UTSW 18 20539935 missense probably benign
R2968:Dsg3 UTSW 18 20525225 missense possibly damaging 0.75
R3906:Dsg3 UTSW 18 20538499 missense probably damaging 1.00
R4616:Dsg3 UTSW 18 20531559 missense probably benign
R4641:Dsg3 UTSW 18 20520558 missense probably benign 0.28
R4685:Dsg3 UTSW 18 20539736 missense probably benign 0.08
R5690:Dsg3 UTSW 18 20522051 missense probably benign 0.01
R5786:Dsg3 UTSW 18 20521571 missense possibly damaging 0.46
R5950:Dsg3 UTSW 18 20538529 missense probably damaging 1.00
R6131:Dsg3 UTSW 18 20538512 missense probably damaging 0.99
R6131:Dsg3 UTSW 18 20520477 splice site probably null
R6243:Dsg3 UTSW 18 20539724 missense probably damaging 1.00
R6315:Dsg3 UTSW 18 20524586 missense probably benign 0.08
R6327:Dsg3 UTSW 18 20539870 missense probably benign
R6418:Dsg3 UTSW 18 20523760 critical splice donor site probably null
R6497:Dsg3 UTSW 18 20537248 missense probably benign 0.33
R6518:Dsg3 UTSW 18 20533422 missense probably benign 0.23
R6551:Dsg3 UTSW 18 20539911 missense unknown
R6685:Dsg3 UTSW 18 20520615 critical splice donor site probably null
R6952:Dsg3 UTSW 18 20525159 missense possibly damaging 0.77
R7357:Dsg3 UTSW 18 20539783 missense probably damaging 1.00
R7385:Dsg3 UTSW 18 20540197 missense possibly damaging 0.52
R7456:Dsg3 UTSW 18 20531363 missense probably benign 0.17
R7506:Dsg3 UTSW 18 20533464 missense probably benign 0.31
R7570:Dsg3 UTSW 18 20527780 missense possibly damaging 0.95
R7980:Dsg3 UTSW 18 20531360 missense probably benign 0.00
R8100:Dsg3 UTSW 18 20528971 missense probably benign 0.08
R8147:Dsg3 UTSW 18 20540073 missense probably benign
R8242:Dsg3 UTSW 18 20536923 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGACCAAATGATGCCTAGTCTCAC -3'
(R):5'- TTGCTCGTCATCGGCTTAGAG -3'

Sequencing Primer
(F):5'- ATGCCTAGTCTCACTGTGATTTG -3'
(R):5'- CTCGTCATCGGCTTAGAGAATGAC -3'
Posted On2018-05-21