Incidental Mutation 'R9336:Dsg3'
ID 707198
Institutional Source Beutler Lab
Gene Symbol Dsg3
Ensembl Gene ENSMUSG00000056632
Gene Name desmoglein 3
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock # R9336 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 20510304-20541310 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 20524685 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 271 (Q271K)
Ref Sequence ENSEMBL: ENSMUSP00000064718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070892]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000070892
AA Change: Q271K

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000064718
Gene: ENSMUSG00000056632
AA Change: Q271K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.9e-13 SMART
CA 179 265 2.36e-21 SMART
CA 288 382 1.55e-7 SMART
CA 409 493 6.15e-11 SMART
low complexity region 615 638 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
low complexity region 725 736 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein exhibit loss of keratinocyte cell adhesion resulting in a phenotype that resembles that of patients with pemphigus vulgaris. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutants display runting from decreased food intake due to oropharyngeal epithelial lesions, blisters around snout and eyes, hair loss by weaning, and hair regrowth with bald patches throughout life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik C T 4: 147,945,033 R487C probably benign Het
2610044O15Rik8 A T 8: 129,217,668 D91E unknown Het
2900026A02Rik A T 5: 113,093,100 probably null Het
9130011E15Rik A T 19: 45,956,681 M277K probably damaging Het
Adamts15 T A 9: 30,904,789 T625S probably damaging Het
Adamtsl1 T C 4: 86,322,027 V675A probably benign Het
Ank3 A T 10: 69,973,748 T1120S probably benign Het
Babam2 A T 5: 31,701,850 M1L possibly damaging Het
Cadm3 G A 1: 173,341,219 Q261* probably null Het
Cdc27 A T 11: 104,505,670 D802E probably benign Het
Cfap206 C T 4: 34,716,494 V324I probably benign Het
Cfap44 T C 16: 44,422,444 I737T probably damaging Het
Chrm3 A T 13: 9,878,616 I128N probably damaging Het
Cyfip1 T A 7: 55,904,441 S743T probably benign Het
Ddias A G 7: 92,858,106 V867A possibly damaging Het
Ddx20 G C 3: 105,678,587 T814R possibly damaging Het
Dgka A T 10: 128,731,066 probably null Het
Dnah9 A T 11: 65,870,949 V3905E probably damaging Het
Dvl2 T A 11: 70,006,354 I294N probably damaging Het
E2f3 G A 13: 29,911,256 H350Y possibly damaging Het
Eif2b5 G A 16: 20,505,277 D457N probably damaging Het
Erbb3 T C 10: 128,585,060 T125A probably benign Het
Etv5 A C 16: 22,435,877 C78G probably benign Het
Frrs1 G A 3: 116,890,933 R263H probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Hivep3 A T 4: 120,095,203 I239F possibly damaging Het
Ifi208 C T 1: 173,682,828 T183I probably damaging Het
Ifitm2 AG A 7: 140,955,901 probably null Het
Igkv1-88 T A 6: 68,862,329 I100F probably damaging Het
Kmt2c T C 5: 25,409,167 N185S probably benign Het
Kmt2d A C 15: 98,845,816 L3821R unknown Het
Krtap22-2 T G 16: 89,010,590 Y40S unknown Het
Lrrc1 A G 9: 77,442,198 V362A probably damaging Het
Malsu1 T A 6: 49,084,515 I171N probably damaging Het
Mark1 C T 1: 184,916,148 G314S possibly damaging Het
Mib2 T C 4: 155,658,937 N135S probably benign Het
Mos A T 4: 3,870,886 L310Q probably damaging Het
Muc4 C T 16: 32,750,938 T272I possibly damaging Het
Myo15b A G 11: 115,880,238 T1654A Het
Napsa G T 7: 44,582,345 G153W probably damaging Het
Nos3 A C 5: 24,379,763 I722L probably benign Het
Olfr1457 A T 19: 13,095,149 S166R probably benign Het
Olfr406 A T 11: 74,269,917 D176V probably damaging Het
Olfr419 A T 1: 174,250,113 D271E probably damaging Het
Olfr555 A T 7: 102,658,992 H57L probably damaging Het
P4ha2 T A 11: 54,111,564 D109E possibly damaging Het
Pappa G T 4: 65,124,681 C47F unknown Het
Pbx3 T A 2: 34,371,820 H34L probably benign Het
Pcca A G 14: 122,650,326 T234A probably benign Het
Pcdha11 C T 18: 37,011,461 R202W probably damaging Het
Pcdhga1 T G 18: 37,662,198 V85G probably damaging Het
Pclo A G 5: 14,676,548 I1807V unknown Het
Pgm3 A T 9: 86,555,360 F528Y probably benign Het
Pigz T C 16: 31,944,876 Y251H probably damaging Het
Pik3c2g G T 6: 139,875,435 Q687H Het
Pja2 A T 17: 64,283,437 N700K unknown Het
Pkd2l2 T C 18: 34,428,105 F389L probably damaging Het
Plcz1 T A 6: 140,039,720 T32S possibly damaging Het
Pola2 A G 19: 5,941,001 V555A possibly damaging Het
Ppp4r3a A C 12: 101,049,660 C541G probably benign Het
Prr15l A T 11: 96,934,773 K76N probably damaging Het
Psg28 C A 7: 18,422,980 K443N possibly damaging Het
Ptch2 G T 4: 117,097,000 A76S probably damaging Het
Ptch2 A G 4: 117,109,579 D553G possibly damaging Het
Ptprz1 T C 6: 23,000,856 S982P probably benign Het
Rnd3 T C 2: 51,148,832 I15V probably benign Het
Rtn3 T C 19: 7,482,963 K41E unknown Het
Sap25 T C 5: 137,641,723 S30P probably benign Het
Scfd2 A T 5: 74,531,345 I92N probably damaging Het
Sdr16c5 T C 4: 4,016,108 Y106C probably damaging Het
Sell T C 1: 164,065,608 I131T probably damaging Het
Sesn3 T A 9: 14,314,554 V195D probably damaging Het
Setdb2 A G 14: 59,423,367 V109A unknown Het
Skint2 T C 4: 112,625,857 I153T probably benign Het
Slc22a1 A G 17: 12,667,255 S164P probably damaging Het
Sowahc G A 10: 59,222,483 G147D probably benign Het
Strip2 G C 6: 29,931,825 G456R probably benign Het
Synpo G T 18: 60,602,400 R825S probably damaging Het
Tango6 A G 8: 106,689,069 D174G probably benign Het
Tas1r2 T C 4: 139,662,005 F433S probably damaging Het
Tas2r126 T C 6: 42,434,943 S137P probably benign Het
Tbc1d15 A G 10: 115,208,961 F512S probably damaging Het
Tenm3 A T 8: 48,417,080 L226Q probably damaging Het
Tmod1 A G 4: 46,078,368 T59A probably damaging Het
Tmprss9 T A 10: 80,894,953 M771K probably benign Het
Trim29 T C 9: 43,327,053 Y485H possibly damaging Het
Ttc17 T C 2: 94,358,853 K144E probably benign Het
Ttc21b A G 2: 66,226,943 Y562H probably benign Het
Ugt2b5 T C 5: 87,137,271 H269R probably benign Het
Utp20 A G 10: 88,813,936 F471L probably damaging Het
Vmn2r120 T A 17: 57,525,201 D196V possibly damaging Het
Wdr72 T C 9: 74,210,010 V680A probably damaging Het
Wee1 G A 7: 110,122,482 G45S probably damaging Het
Zfp518a G A 19: 40,912,781 V385I probably benign Het
Other mutations in Dsg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Dsg3 APN 18 20539654 missense probably damaging 1.00
IGL00697:Dsg3 APN 18 20524689 critical splice donor site probably null
IGL00966:Dsg3 APN 18 20523607 missense probably benign 0.02
IGL01352:Dsg3 APN 18 20523696 missense probably benign 0.25
IGL01953:Dsg3 APN 18 20525304 missense probably damaging 1.00
IGL02385:Dsg3 APN 18 20527714 missense probably damaging 1.00
IGL02622:Dsg3 APN 18 20528947 splice site probably benign
IGL02643:Dsg3 APN 18 20528955 missense probably benign 0.00
IGL02740:Dsg3 APN 18 20527708 missense possibly damaging 0.93
IGL03012:Dsg3 APN 18 20537243 critical splice acceptor site probably null
IGL03026:Dsg3 APN 18 20536972 splice site probably null
IGL03063:Dsg3 APN 18 20533368 splice site probably benign
IGL03098:Dsg3 APN 18 20510365 utr 5 prime probably benign
IGL03132:Dsg3 APN 18 20524596 missense probably damaging 1.00
IGL03352:Dsg3 APN 18 20527632 missense probably benign
P0035:Dsg3 UTSW 18 20539969 missense probably benign 0.05
R0039:Dsg3 UTSW 18 20521484 missense probably benign 0.36
R0099:Dsg3 UTSW 18 20540022 missense probably benign 0.01
R0109:Dsg3 UTSW 18 20540134 missense probably damaging 0.96
R0109:Dsg3 UTSW 18 20540134 missense probably damaging 0.96
R0143:Dsg3 UTSW 18 20536825 missense probably damaging 1.00
R0194:Dsg3 UTSW 18 20540142 missense probably damaging 1.00
R0373:Dsg3 UTSW 18 20539747 missense probably damaging 1.00
R0517:Dsg3 UTSW 18 20529025 missense probably benign 0.06
R0521:Dsg3 UTSW 18 20527815 missense possibly damaging 0.53
R1194:Dsg3 UTSW 18 20525220 missense probably damaging 0.98
R1551:Dsg3 UTSW 18 20536918 missense possibly damaging 0.84
R1762:Dsg3 UTSW 18 20539732 missense probably damaging 1.00
R1957:Dsg3 UTSW 18 20522105 missense probably damaging 1.00
R2061:Dsg3 UTSW 18 20527737 nonsense probably null
R2071:Dsg3 UTSW 18 20536825 missense probably damaging 1.00
R2513:Dsg3 UTSW 18 20523662 missense possibly damaging 0.48
R2571:Dsg3 UTSW 18 20540005 missense probably benign 0.01
R2945:Dsg3 UTSW 18 20539935 missense probably benign
R2968:Dsg3 UTSW 18 20525225 missense possibly damaging 0.75
R3906:Dsg3 UTSW 18 20538499 missense probably damaging 1.00
R4616:Dsg3 UTSW 18 20531559 missense probably benign
R4641:Dsg3 UTSW 18 20520558 missense probably benign 0.28
R4685:Dsg3 UTSW 18 20539736 missense probably benign 0.08
R5690:Dsg3 UTSW 18 20522051 missense probably benign 0.01
R5786:Dsg3 UTSW 18 20521571 missense possibly damaging 0.46
R5950:Dsg3 UTSW 18 20538529 missense probably damaging 1.00
R6131:Dsg3 UTSW 18 20538512 missense probably damaging 0.99
R6131:Dsg3 UTSW 18 20520477 splice site probably null
R6243:Dsg3 UTSW 18 20539724 missense probably damaging 1.00
R6315:Dsg3 UTSW 18 20524586 missense probably benign 0.08
R6327:Dsg3 UTSW 18 20539870 missense probably benign
R6418:Dsg3 UTSW 18 20523760 critical splice donor site probably null
R6464:Dsg3 UTSW 18 20533526 missense probably benign 0.00
R6497:Dsg3 UTSW 18 20537248 missense probably benign 0.33
R6518:Dsg3 UTSW 18 20533422 missense probably benign 0.23
R6551:Dsg3 UTSW 18 20539911 missense unknown
R6685:Dsg3 UTSW 18 20520615 critical splice donor site probably null
R6952:Dsg3 UTSW 18 20525159 missense possibly damaging 0.77
R7357:Dsg3 UTSW 18 20539783 missense probably damaging 1.00
R7385:Dsg3 UTSW 18 20540197 missense possibly damaging 0.52
R7456:Dsg3 UTSW 18 20531363 missense probably benign 0.17
R7506:Dsg3 UTSW 18 20533464 missense probably benign 0.31
R7570:Dsg3 UTSW 18 20527780 missense possibly damaging 0.95
R7980:Dsg3 UTSW 18 20531360 missense probably benign 0.00
R8100:Dsg3 UTSW 18 20528971 missense probably benign 0.08
R8147:Dsg3 UTSW 18 20540073 missense probably benign
R8242:Dsg3 UTSW 18 20536923 missense possibly damaging 0.93
R8415:Dsg3 UTSW 18 20523708 missense probably damaging 1.00
R8494:Dsg3 UTSW 18 20540214 missense probably benign 0.03
R8930:Dsg3 UTSW 18 20539661 missense probably damaging 1.00
R8932:Dsg3 UTSW 18 20539661 missense probably damaging 1.00
R8998:Dsg3 UTSW 18 20533627 missense probably damaging 1.00
R8999:Dsg3 UTSW 18 20533627 missense probably damaging 1.00
R9498:Dsg3 UTSW 18 20525221 missense probably damaging 0.98
R9598:Dsg3 UTSW 18 20539732 missense probably damaging 1.00
R9601:Dsg3 UTSW 18 20533521 missense probably damaging 1.00
R9748:Dsg3 UTSW 18 20539704 missense possibly damaging 0.87
R9794:Dsg3 UTSW 18 20540097 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGTGTGAGAGCTATGATTCACG -3'
(R):5'- CCTCTTGATGGGTGCTCAAG -3'

Sequencing Primer
(F):5'- TATCCAACAAAAGCTACTATTGGAC -3'
(R):5'- GGCAGTTAATGAATTGGGA -3'
Posted On 2022-04-18