Incidental Mutation 'R6424:Scgb2b19'
ID518261
Institutional Source Beutler Lab
Gene Symbol Scgb2b19
Ensembl Gene ENSMUSG00000096467
Gene Namesecretoglobin, family 2B, member 19
SynonymsGm5894, Abpbg19
MMRRC Submission 044387-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.033) question?
Stock #R6424 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location33278370-33280338 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 33278597 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 92 (S92A)
Ref Sequence ENSEMBL: ENSMUSP00000136155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179688]
Predicted Effect possibly damaging
Transcript: ENSMUST00000179688
AA Change: S92A

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136155
Gene: ENSMUSG00000096467
AA Change: S92A

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:Feld-I_B 24 90 2.4e-31 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,510,542 V4184A probably benign Het
Acvr2b T A 9: 119,402,579 W12R probably benign Het
Arap2 T C 5: 62,683,364 K720E probably damaging Het
Cr1l A C 1: 195,117,815 F184V probably damaging Het
Haus8 C T 8: 71,251,436 W359* probably null Het
Insm2 A T 12: 55,600,082 I204F probably damaging Het
Katnb1 T A 8: 95,093,516 I97N probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Map2 A T 1: 66,414,787 K945N possibly damaging Het
Meltf T A 16: 31,880,262 C63* probably null Het
Nbas T C 12: 13,415,733 probably null Het
Olfr491 G A 7: 108,317,205 V104I probably benign Het
Raf1 T C 6: 115,619,581 E594G probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Serpinb3c T A 1: 107,271,629 *387Y probably null Het
Shpk A T 11: 73,213,492 I156F possibly damaging Het
Smarcd1 T C 15: 99,704,367 F128L probably damaging Het
Tarsl2 G A 7: 65,655,739 G237E probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Ttn T C 2: 76,889,504 probably benign Het
Vmn1r223 T A 13: 23,250,175 I313N probably damaging Het
Other mutations in Scgb2b19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Scgb2b19 APN 7 33279728 missense probably damaging 0.99
PIT4515001:Scgb2b19 UTSW 7 33279611 critical splice donor site probably null
R0580:Scgb2b19 UTSW 7 33278570 missense probably benign 0.15
R1437:Scgb2b19 UTSW 7 33278555 missense probably benign 0.08
R1445:Scgb2b19 UTSW 7 33279612 critical splice donor site probably null
R5332:Scgb2b19 UTSW 7 33278581 missense probably benign 0.07
R7102:Scgb2b19 UTSW 7 33280286 missense probably null
R7576:Scgb2b19 UTSW 7 33279786 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGGAACAGTATCAGGAATCCAACTTC -3'
(R):5'- ATAGTGGTTTTCAGGCTGCC -3'

Sequencing Primer
(F):5'- TATCAGGAATCCAACTTCAGGAG -3'
(R):5'- CCAGTTCCCTTGAGGCAGAATTTG -3'
Posted On2018-05-24