Incidental Mutation 'R6455:Fbxl13'
ID519528
Institutional Source Beutler Lab
Gene Symbol Fbxl13
Ensembl Gene ENSMUSG00000048520
Gene NameF-box and leucine-rich repeat protein 13
Synonyms4921539K22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6455 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location21483847-21645634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 21556814 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 341 (S341F)
Ref Sequence ENSEMBL: ENSMUSP00000110889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035651] [ENSMUST00000051358] [ENSMUST00000115234]
Predicted Effect probably benign
Transcript: ENSMUST00000035651
SMART Domains Protein: ENSMUSP00000038569
Gene: ENSMUSG00000039883

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
Blast:LRR 83 105 8e-6 BLAST
LRR 106 129 9.96e-1 SMART
LRR 130 153 1.07e0 SMART
LRRCT 165 215 8.98e-4 SMART
LRR 270 292 8.73e1 SMART
LRR 293 316 3.52e-1 SMART
LRR 317 340 7.55e-1 SMART
LRRCT 352 403 8.95e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051358
AA Change: S341F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000052716
Gene: ENSMUSG00000048520
AA Change: S341F

DomainStartEndE-ValueType
low complexity region 160 173 N/A INTRINSIC
FBOX 243 283 3.73e-4 SMART
LRR_CC 328 353 6.62e-6 SMART
LRR 354 378 3.67e2 SMART
LRR 379 404 2.75e-3 SMART
LRR 407 425 4.51e2 SMART
LRR 426 451 2.63e0 SMART
LRR 476 501 4.15e1 SMART
LRR 502 526 1.82e1 SMART
LRR 529 554 1.76e-1 SMART
LRR_CC 555 580 4.61e-5 SMART
LRR 604 629 8.81e-2 SMART
LRR 630 655 2.37e1 SMART
LRR 656 681 3.21e-4 SMART
LRR 682 707 6.57e-1 SMART
LRR 708 733 9.47e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115234
AA Change: S341F

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000110889
Gene: ENSMUSG00000048520
AA Change: S341F

DomainStartEndE-ValueType
low complexity region 160 173 N/A INTRINSIC
FBOX 243 283 3.73e-4 SMART
LRR_CC 328 353 6.62e-6 SMART
LRR 354 378 3.67e2 SMART
LRR 379 404 2.75e-3 SMART
LRR 407 432 6.88e-4 SMART
Blast:LRR 433 458 7e-8 BLAST
LRR 459 484 2.63e0 SMART
LRR 509 534 4.15e1 SMART
LRR 535 559 1.82e1 SMART
LRR 562 587 1.76e-1 SMART
LRR_CC 588 613 4.61e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199277
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXL13, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik T A 9: 35,844,055 K3* probably null Het
A430078G23Rik A T 8: 3,388,753 Y370F probably benign Het
Abca1 T C 4: 53,042,376 R1899G probably damaging Het
Abca6 C T 11: 110,241,581 G296D probably damaging Het
Abcb5 A T 12: 118,890,549 probably null Het
Adam28 T G 14: 68,633,208 T339P probably damaging Het
Adcy10 C G 1: 165,518,374 Q331E probably damaging Het
Aldh1a2 A T 9: 71,252,914 probably null Het
Alms1 T A 6: 85,696,657 I3078N probably damaging Het
Amtn A T 5: 88,380,280 N71Y probably damaging Het
Arid4a T C 12: 71,075,088 S748P probably benign Het
Atp2b1 C A 10: 99,016,980 Q108K possibly damaging Het
Bcdin3d T C 15: 99,470,949 D123G probably benign Het
Capn15 A G 17: 25,965,436 S24P probably damaging Het
Cc2d2a T A 5: 43,739,412 S1550R possibly damaging Het
Ccdc7a C T 8: 128,832,610 V1174M probably damaging Het
Cd22 T A 7: 30,876,153 I155F probably damaging Het
Ceacam3 T C 7: 17,161,938 I611T possibly damaging Het
Chrna1 C T 2: 73,566,836 D370N possibly damaging Het
Diexf G T 1: 193,128,376 D106E probably benign Het
Dlg2 C A 7: 92,444,508 probably null Het
Dll4 A T 2: 119,333,795 probably null Het
Eif5b T C 1: 38,019,027 S137P probably benign Het
Epn2 A T 11: 61,533,641 M250K probably damaging Het
Fat2 T A 11: 55,270,457 Q3149L probably damaging Het
Gm15922 T A 7: 3,738,931 Y150F probably benign Het
Gm5141 A T 13: 62,774,783 C191S probably damaging Het
Gm5150 C T 3: 15,990,651 G137S probably damaging Het
Gm5346 T A 8: 43,626,152 H345L probably damaging Het
Gpr75 C T 11: 30,891,529 R145W probably damaging Het
Heatr5b G A 17: 78,753,073 H2058Y probably benign Het
Ina G A 19: 47,023,561 E473K probably benign Het
Irx6 T C 8: 92,676,072 S22P probably benign Het
Itpr1 T A 6: 108,417,972 M32K probably damaging Het
Jmjd1c T A 10: 67,226,016 S1383T probably benign Het
Lclat1 T A 17: 73,161,833 S3T probably damaging Het
Llgl1 G A 11: 60,709,660 V612M probably damaging Het
Mios A G 6: 8,231,239 R708G probably benign Het
Mphosph8 T C 14: 56,688,486 L636P probably damaging Het
Mrgpra2b T A 7: 47,464,145 N254Y probably damaging Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Myog G A 1: 134,290,488 D145N probably benign Het
Nat10 T A 2: 103,739,886 I371F possibly damaging Het
Neb A T 2: 52,167,644 Y229* probably null Het
Nlrp6 T A 7: 140,927,509 I896K possibly damaging Het
Olfr235 T C 19: 12,268,706 S159P probably damaging Het
Olfr551 G A 7: 102,588,671 A24V probably benign Het
Olfr740 A T 14: 50,453,585 I178L possibly damaging Het
Pcdhgc5 A C 18: 37,821,248 E525A probably damaging Het
Pkd2 C A 5: 104,459,924 D96E probably benign Het
Prtg A G 9: 72,907,856 D1022G probably damaging Het
Ptpn13 T C 5: 103,541,284 M981T probably benign Het
Rc3h2 C A 2: 37,409,470 A183S probably damaging Het
Rorb A T 19: 18,960,492 I270N probably damaging Het
Rpgrip1 C T 14: 52,141,189 R524W probably damaging Het
Slc25a10 T C 11: 120,495,205 V124A probably damaging Het
Slc40a1 T A 1: 45,918,947 I109F probably damaging Het
Spen G A 4: 141,475,509 R1936W probably damaging Het
St6gal2 T A 17: 55,482,513 Y183N probably benign Het
Svil A G 18: 5,056,629 K588E possibly damaging Het
Tas2r122 C T 6: 132,711,663 W89* probably null Het
Tbxas1 T A 6: 38,952,145 probably benign Het
Tia1 T A 6: 86,420,378 I111N probably damaging Het
Tlr9 T A 9: 106,223,999 L163H probably damaging Het
Tnn C T 1: 160,114,719 V806M probably damaging Het
Traf5 G A 1: 191,999,926 A318V probably benign Het
Ttc3 T A 16: 94,418,623 M1K probably null Het
Vmn1r192 T A 13: 22,187,830 R73S probably benign Het
Vmn1r71 T C 7: 10,748,404 Y53C probably benign Het
Vmn2r34 T A 7: 7,683,583 N372Y probably damaging Het
Wbp2 A T 11: 116,079,753 S229R probably damaging Het
Wdr18 C T 10: 79,965,281 T176I probably damaging Het
Other mutations in Fbxl13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Fbxl13 APN 5 21490414 missense possibly damaging 0.81
IGL02178:Fbxl13 APN 5 21620720 missense possibly damaging 0.56
IGL02271:Fbxl13 APN 5 21490456 missense probably damaging 1.00
IGL02317:Fbxl13 APN 5 21522234 missense probably benign 0.28
IGL02508:Fbxl13 APN 5 21556805 critical splice donor site probably null
IGL02891:Fbxl13 APN 5 21522100 splice site probably benign
IGL03387:Fbxl13 APN 5 21523798 critical splice donor site probably null
Laurel UTSW 5 21582053 nonsense probably null
PIT4305001:Fbxl13 UTSW 5 21522148 missense probably benign
R0040:Fbxl13 UTSW 5 21486373 missense probably damaging 1.00
R0040:Fbxl13 UTSW 5 21486373 missense probably damaging 1.00
R0278:Fbxl13 UTSW 5 21523910 missense probably benign 0.03
R0597:Fbxl13 UTSW 5 21614714 missense probably benign 0.09
R1110:Fbxl13 UTSW 5 21484036 missense probably benign
R1172:Fbxl13 UTSW 5 21620604 splice site probably benign
R1175:Fbxl13 UTSW 5 21620604 splice site probably benign
R1464:Fbxl13 UTSW 5 21483991 missense probably benign 0.21
R1464:Fbxl13 UTSW 5 21483991 missense probably benign 0.21
R2174:Fbxl13 UTSW 5 21582048 missense possibly damaging 0.74
R2426:Fbxl13 UTSW 5 21522137 missense probably damaging 1.00
R4171:Fbxl13 UTSW 5 21543788 missense probably benign 0.02
R4413:Fbxl13 UTSW 5 21582053 nonsense probably null
R4655:Fbxl13 UTSW 5 21582039 missense probably damaging 1.00
R4816:Fbxl13 UTSW 5 21484003 missense probably benign 0.25
R5544:Fbxl13 UTSW 5 21524491 missense probably damaging 0.96
R5979:Fbxl13 UTSW 5 21582091 missense probably damaging 1.00
R6176:Fbxl13 UTSW 5 21500500 missense possibly damaging 0.83
R6211:Fbxl13 UTSW 5 21484021 missense possibly damaging 0.57
R6252:Fbxl13 UTSW 5 21621501 missense possibly damaging 0.96
R6336:Fbxl13 UTSW 5 21523547 critical splice donor site probably null
R6522:Fbxl13 UTSW 5 21561556 splice site probably null
R6827:Fbxl13 UTSW 5 21522178 missense probably damaging 0.97
R6961:Fbxl13 UTSW 5 21543742 missense probably damaging 1.00
R6998:Fbxl13 UTSW 5 21543689 missense probably damaging 1.00
R6998:Fbxl13 UTSW 5 21620613 missense probably null 0.03
R7152:Fbxl13 UTSW 5 21582067 missense possibly damaging 0.95
R7196:Fbxl13 UTSW 5 21486303 missense probably damaging 0.97
R7418:Fbxl13 UTSW 5 21581983 missense probably benign 0.00
R7490:Fbxl13 UTSW 5 21523060 nonsense probably null
R7649:Fbxl13 UTSW 5 21614666 missense probably benign 0.13
R7816:Fbxl13 UTSW 5 21543787 missense probably benign 0.11
R7954:Fbxl13 UTSW 5 21543769 missense probably benign 0.19
R8036:Fbxl13 UTSW 5 21523568 missense probably damaging 1.00
R8098:Fbxl13 UTSW 5 21620718 missense probably benign 0.00
R8406:Fbxl13 UTSW 5 21523654 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGATGAACGATAGCATTGTGC -3'
(R):5'- GCCAAAGACATCATTTGCCTGAG -3'

Sequencing Primer
(F):5'- GCATTGTGCAGGGGGTG -3'
(R):5'- TGAGCAGAGAAACCCACATACTTAGG -3'
Posted On2018-05-24