Incidental Mutation 'R8036:Fbxl13'
ID618230
Institutional Source Beutler Lab
Gene Symbol Fbxl13
Ensembl Gene ENSMUSG00000048520
Gene NameF-box and leucine-rich repeat protein 13
Synonyms4921539K22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8036 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location21483847-21645634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21523568 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 508 (N508Y)
Ref Sequence ENSEMBL: ENSMUSP00000052716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051358] [ENSMUST00000115234]
Predicted Effect probably damaging
Transcript: ENSMUST00000051358
AA Change: N508Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052716
Gene: ENSMUSG00000048520
AA Change: N508Y

DomainStartEndE-ValueType
low complexity region 160 173 N/A INTRINSIC
FBOX 243 283 3.73e-4 SMART
LRR_CC 328 353 6.62e-6 SMART
LRR 354 378 3.67e2 SMART
LRR 379 404 2.75e-3 SMART
LRR 407 425 4.51e2 SMART
LRR 426 451 2.63e0 SMART
LRR 476 501 4.15e1 SMART
LRR 502 526 1.82e1 SMART
LRR 529 554 1.76e-1 SMART
LRR_CC 555 580 4.61e-5 SMART
LRR 604 629 8.81e-2 SMART
LRR 630 655 2.37e1 SMART
LRR 656 681 3.21e-4 SMART
LRR 682 707 6.57e-1 SMART
LRR 708 733 9.47e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115234
AA Change: N541Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110889
Gene: ENSMUSG00000048520
AA Change: N541Y

DomainStartEndE-ValueType
low complexity region 160 173 N/A INTRINSIC
FBOX 243 283 3.73e-4 SMART
LRR_CC 328 353 6.62e-6 SMART
LRR 354 378 3.67e2 SMART
LRR 379 404 2.75e-3 SMART
LRR 407 432 6.88e-4 SMART
Blast:LRR 433 458 7e-8 BLAST
LRR 459 484 2.63e0 SMART
LRR 509 534 4.15e1 SMART
LRR 535 559 1.82e1 SMART
LRR 562 587 1.76e-1 SMART
LRR_CC 588 613 4.61e-5 SMART
Meta Mutation Damage Score 0.4551 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXL13, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,678,177 I181F probably damaging Het
Abcc3 A G 11: 94,345,992 V1473A possibly damaging Het
Akap9 T A 5: 4,070,397 C3604* probably null Het
Alas1 A G 9: 106,235,522 I545T probably benign Het
Anpep A C 7: 79,841,898 D118E probably benign Het
Arhgef17 A T 7: 100,929,855 S629T probably damaging Het
Arid2 C T 15: 96,368,744 R558C probably damaging Het
Camk2n1 A G 4: 138,456,745 D65G probably damaging Het
Ccdc114 A G 7: 45,942,852 D352G probably benign Het
Ccdc177 T C 12: 80,758,123 N459S unknown Het
Cenpe ACTCTCT ACTCT 3: 135,239,848 probably null Het
Crb1 T C 1: 139,237,384 I1062V probably benign Het
Decr2 A G 17: 26,082,988 L256P probably damaging Het
Dhx37 T C 5: 125,424,675 M507V probably benign Het
Disp1 A G 1: 183,089,239 I539T probably damaging Het
Dqx1 T A 6: 83,059,807 V264E probably damaging Het
Enpp4 A G 17: 44,102,245 S133P possibly damaging Het
Fam149a T C 8: 45,349,011 T476A probably benign Het
Fam20b A G 1: 156,705,837 W70R probably damaging Het
Fjx1 A G 2: 102,450,375 L405P probably damaging Het
Fn1 G A 1: 71,590,151 Q2399* probably null Het
Foxa2 G C 2: 148,043,989 T308S probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm10521 A G 1: 171,896,185 D21G unknown Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Herpud1 A G 8: 94,392,386 E256G probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kctd13 A G 7: 126,929,242 D63G possibly damaging Het
Lamp3 C A 16: 19,701,059 D125Y probably damaging Het
Luzp2 A G 7: 55,075,075 D128G probably damaging Het
Lyve1 A G 7: 110,859,442 C105R probably damaging Het
Mlkl A T 8: 111,333,454 V100E probably damaging Het
Muc5b T C 7: 141,867,741 S4323P possibly damaging Het
Myoz3 T G 18: 60,580,850 probably null Het
Nlrp9c T A 7: 26,371,439 N906Y possibly damaging Het
Olfr1132 C T 2: 87,635,503 M81I probably benign Het
Olfr248 A G 1: 174,391,816 H249R probably damaging Het
Olfr564 A T 7: 102,803,556 H26L possibly damaging Het
Olfr913 T C 9: 38,594,890 F223S probably benign Het
Pcsk9 G A 4: 106,454,339 H232Y possibly damaging Het
Plec A G 15: 76,179,180 I2230T possibly damaging Het
Pou2f3 T A 9: 43,146,908 T47S probably damaging Het
Rab8a A T 8: 72,174,595 I106F probably damaging Het
Ros1 A T 10: 52,165,343 S295T probably benign Het
Sh3yl1 T A 12: 30,942,099 N222K possibly damaging Het
Slc6a9 C T 4: 117,867,886 A559V possibly damaging Het
Spata20 T G 11: 94,479,137 I778L probably benign Het
Taar1 A T 10: 23,921,135 T244S probably benign Het
Tmem229b C A 12: 78,965,088 C23F probably damaging Het
Ttll4 A G 1: 74,679,230 Y80C probably benign Het
Ube2m G A 7: 13,035,639 T176I probably benign Het
Zfp790 G A 7: 29,828,921 A344T possibly damaging Het
Zfp90 G A 8: 106,419,128 V31M probably benign Het
Zswim4 C T 8: 84,223,289 R659Q probably benign Het
Other mutations in Fbxl13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Fbxl13 APN 5 21490414 missense possibly damaging 0.81
IGL02178:Fbxl13 APN 5 21620720 missense possibly damaging 0.56
IGL02271:Fbxl13 APN 5 21490456 missense probably damaging 1.00
IGL02317:Fbxl13 APN 5 21522234 missense probably benign 0.28
IGL02508:Fbxl13 APN 5 21556805 critical splice donor site probably null
IGL02891:Fbxl13 APN 5 21522100 splice site probably benign
IGL03387:Fbxl13 APN 5 21523798 critical splice donor site probably null
Laurel UTSW 5 21582053 nonsense probably null
PIT4305001:Fbxl13 UTSW 5 21522148 missense probably benign
R0040:Fbxl13 UTSW 5 21486373 missense probably damaging 1.00
R0040:Fbxl13 UTSW 5 21486373 missense probably damaging 1.00
R0278:Fbxl13 UTSW 5 21523910 missense probably benign 0.03
R0597:Fbxl13 UTSW 5 21614714 missense probably benign 0.09
R1110:Fbxl13 UTSW 5 21484036 missense probably benign
R1172:Fbxl13 UTSW 5 21620604 splice site probably benign
R1175:Fbxl13 UTSW 5 21620604 splice site probably benign
R1464:Fbxl13 UTSW 5 21483991 missense probably benign 0.21
R1464:Fbxl13 UTSW 5 21483991 missense probably benign 0.21
R2174:Fbxl13 UTSW 5 21582048 missense possibly damaging 0.74
R2426:Fbxl13 UTSW 5 21522137 missense probably damaging 1.00
R4171:Fbxl13 UTSW 5 21543788 missense probably benign 0.02
R4413:Fbxl13 UTSW 5 21582053 nonsense probably null
R4655:Fbxl13 UTSW 5 21582039 missense probably damaging 1.00
R4816:Fbxl13 UTSW 5 21484003 missense probably benign 0.25
R5544:Fbxl13 UTSW 5 21524491 missense probably damaging 0.96
R5979:Fbxl13 UTSW 5 21582091 missense probably damaging 1.00
R6176:Fbxl13 UTSW 5 21500500 missense possibly damaging 0.83
R6211:Fbxl13 UTSW 5 21484021 missense possibly damaging 0.57
R6252:Fbxl13 UTSW 5 21621501 missense possibly damaging 0.96
R6336:Fbxl13 UTSW 5 21523547 critical splice donor site probably null
R6455:Fbxl13 UTSW 5 21556814 missense probably benign 0.02
R6522:Fbxl13 UTSW 5 21561556 splice site probably null
R6827:Fbxl13 UTSW 5 21522178 missense probably damaging 0.97
R6961:Fbxl13 UTSW 5 21543742 missense probably damaging 1.00
R6998:Fbxl13 UTSW 5 21543689 missense probably damaging 1.00
R6998:Fbxl13 UTSW 5 21620613 missense probably null 0.03
R7152:Fbxl13 UTSW 5 21582067 missense possibly damaging 0.95
R7196:Fbxl13 UTSW 5 21486303 missense probably damaging 0.97
R7418:Fbxl13 UTSW 5 21581983 missense probably benign 0.00
R7490:Fbxl13 UTSW 5 21523060 nonsense probably null
R7649:Fbxl13 UTSW 5 21614666 missense probably benign 0.13
R7816:Fbxl13 UTSW 5 21543787 missense probably benign 0.11
R7954:Fbxl13 UTSW 5 21543769 missense probably benign 0.19
R8098:Fbxl13 UTSW 5 21620718 missense probably benign 0.00
R8406:Fbxl13 UTSW 5 21523654 missense probably damaging 1.00
R8912:Fbxl13 UTSW 5 21522186 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTGGCATCTGCTTCTACACC -3'
(R):5'- AAGGTCTGTGACGCTAGAAACTC -3'

Sequencing Primer
(F):5'- GGCATCTGCTTCTACACCAATTATAG -3'
(R):5'- GTGACGCTAGAAACTCAATTTATCC -3'
Posted On2020-01-23