Mutagenetix > Incidental Mutation

Incidental Mutation 'R6523:Ldlr'

521506

Institutional Source

Beutler Lab

Gene Symbol

Ldlr

Ensembl Gene

ENSMUSG00000032193

Gene Name

low density lipoprotein receptor

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6523 (G1)

Quality Score

181.009

Status

Validated

Chromosome

Chromosomal Location

21723483-21749919 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 21737253 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 285 (C285Y)

Ref Sequence

ENSEMBL: ENSMUSP00000149431 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034713] [ENSMUST00000213114]

AlphaFold

P35951

Predicted Effect

probably damaging
Transcript: ENSMUST00000034713
AA Change: C285Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034713
Gene: ENSMUSG00000032193
AA Change: C285Y

Domain	Start	End	E-Value	Type
low complexity region	13	23	N/A	INTRINSIC
LDLa	26	65	1.89e-14	SMART
LDLa	67	106	9.81e-13	SMART
EGF_like	108	144	6.81e1	SMART
LDLa	108	145	3.77e-14	SMART
LDLa	147	186	6.67e-15	SMART
LDLa	197	234	1.16e-14	SMART
LDLa	236	273	3.24e-13	SMART
LDLa	276	316	1e-9	SMART
EGF	318	354	3.2e-4	SMART
EGF_CA	355	394	4.09e-11	SMART
LY	420	462	1.11e-3	SMART
LY	466	508	4.7e-11	SMART
LY	509	552	5.23e-9	SMART
LY	553	595	7.86e-13	SMART
LY	596	639	3.25e-5	SMART
EGF	666	713	7.64e-2	SMART
low complexity region	799	811	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000213114
AA Change: C285Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214359

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215917

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217111

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217613

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.3%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. Low density lipoprotein (LDL) is normally bound at the cell membrane and taken into the cell ending up in lysosomes where the protein is degraded and the cholesterol is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous targeted mutants exhibit 2X higher total plasma cholesterol and 7-9X higher IDL and LDL levels on a normal diet compared to controls. On a high cholesterol diet, mutant effects dramatically increase and mice develop xanthomatosis and atherosclerosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ackr1	A	G	1: 173,332,553		probably null	Het
Alg2	A	T	4: 47,472,071	S246T	possibly damaging	Het
Ankfy1	G	A	11: 72,730,482	R198Q	possibly damaging	Het
Arid4a	A	G	12: 71,067,341		probably null	Het
AU040320	G	A	4: 126,868,760		probably null	Het
B430306N03Rik	A	G	17: 48,319,165	T129A	possibly damaging	Het
Blvrb	C	A	7: 27,465,717		probably null	Het
Ccdc175	T	C	12: 72,144,791	N337S	probably benign	Het
Ccdc28b	A	C	4: 129,620,987	F110V	probably damaging	Het
Cd200	A	G	16: 45,400,270	Y16H	probably benign	Het
Cfh	T	G	1: 140,101,707	E950A	possibly damaging	Het
Clec3a	A	T	8: 114,425,605	Y117F	probably damaging	Het
CN725425	A	G	15: 91,231,581	S9G	probably benign	Het
Coasy	T	A	11: 101,086,118	W535R	probably damaging	Het
Cox4i1	T	A	8: 120,672,741	S30R	probably benign	Het
Csnk1a1	G	A	18: 61,555,758	S3N	probably benign	Het
Dcst2	C	G	3: 89,373,501	L669V	probably benign	Het
Ddx58	T	A	4: 40,205,947	T882S	probably benign	Het
Dnah14	A	G	1: 181,643,621	I1346V	probably benign	Het
Fbxw24	G	A	9: 109,604,980	R421*	probably null	Het
Fstl5	G	A	3: 76,536,334	V329I	probably benign	Het
Gli3	T	C	13: 15,713,650		probably null	Het
Gm13128	T	C	4: 144,331,648	V275A	probably benign	Het
Gna11	A	T	10: 81,544,854	I25N	probably damaging	Het
Greb1	C	T	12: 16,684,373	V1539I	possibly damaging	Het
Hipk3	T	A	2: 104,439,408	T479S	possibly damaging	Het
Hspa1b	A	G	17: 34,957,191	I606T	probably benign	Het
Idnk	T	A	13: 58,163,643	F141L	probably damaging	Het
Ifit3	A	G	19: 34,588,155	N367S	probably benign	Het
Kcnn1	A	T	8: 70,846,525	D448E	possibly damaging	Het
Krt14	T	C	11: 100,205,097	T212A	possibly damaging	Het
Mark3	G	A	12: 111,627,235	V234I	probably damaging	Het
Meikin	T	A	11: 54,398,501	Y233*	probably null	Het
Muc20	T	C	16: 32,793,450	D519G	possibly damaging	Het
Nalcn	T	A	14: 123,317,843	H876L	probably benign	Het
Ncaph	A	T	2: 127,105,889	I698K	probably damaging	Het
Nipal1	A	T	5: 72,667,608	I215F	probably damaging	Het
Nrde2	A	T	12: 100,134,405	D607E	possibly damaging	Het
Nt5dc2	T	C	14: 31,135,705	F217S	probably damaging	Het
Ntsr2	T	A	12: 16,656,696	S156T	probably benign	Het
Olfr1464-ps1	A	C	19: 13,282,364	D231E	probably benign	Het
Olfr271-ps1	A	T	4: 52,935,500	I261N	probably damaging	Het
Olfr481	A	C	7: 108,081,555	T254P	probably benign	Het
Pfas	A	T	11: 68,990,457	I1028K	probably benign	Het
Pnpla5	C	A	15: 84,115,711	R329L	possibly damaging	Het
Rhot2	A	G	17: 25,839,420	V393A	possibly damaging	Het
Rnase9	T	A	14: 51,039,227	Y98F	possibly damaging	Het
Sacs	C	A	14: 61,202,961	L819I	probably damaging	Het
Sall3	C	T	18: 80,973,188	M508I	possibly damaging	Het
Scube3	G	A	17: 28,162,388	C301Y	probably damaging	Het
Sgo2b	G	T	8: 63,927,504	H765N	probably benign	Het
Sh3gl1	A	T	17: 56,017,617	Y344N	possibly damaging	Het
Slc15a2	A	G	16: 36,752,321	V635A	probably benign	Het
Slc1a4	T	A	11: 20,332,114	Y40F	probably damaging	Het
Slc4a10	A	T	2: 62,286,961	K755*	probably null	Het
Slco1a5	C	T	6: 142,266,395	G38R	probably damaging	Het
Snx25	T	A	8: 46,055,855	D564V	probably damaging	Het
Soga1	G	A	2: 157,060,343	Q251*	probably null	Het
Spon1	T	A	7: 113,886,785	D189E	probably benign	Het
Sptbn5	T	C	2: 120,065,614		probably null	Het
Ssbp2	A	G	13: 91,693,051	I317V	probably benign	Het
Stil	AAGATTTCCAG	A	4: 115,032,714		probably null	Het
Strn3	A	T	12: 51,643,098		probably null	Het
Tcaf2	A	T	6: 42,643,019	F25I	probably benign	Het
Themis	C	T	10: 28,781,898	T154I	possibly damaging	Het
Ttn	T	C	2: 76,796,046	R13176G	probably damaging	Het
Utp4	G	A	8: 106,898,463	V125M	probably damaging	Het
Vmn1r119	T	A	7: 21,011,852	M202L	possibly damaging	Het
Zfp292	G	C	4: 34,816,301	F329L	probably benign	Het
Zfp541	C	T	7: 16,095,520	P1281L	probably damaging	Het
Zfp616	A	T	11: 74,083,142	Q79L	possibly damaging	Het

Other mutations in Ldlr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Ldlr	APN	9	21735361	critical splice donor site	probably null
IGL01975:Ldlr	APN	9	21733697	missense	probably benign	0.05
IGL02043:Ldlr	APN	9	21733499	missense	probably benign	0.03
IGL02524:Ldlr	APN	9	21733681	missense	probably damaging	1.00
IGL03049:Ldlr	APN	9	21745819	missense	probably benign	0.00
IGL03113:Ldlr	APN	9	21739828	missense	possibly damaging	0.85
R0240:Ldlr	UTSW	9	21737999	splice site	probably benign
R0586:Ldlr	UTSW	9	21739744	missense	probably benign	0.00
R1398:Ldlr	UTSW	9	21739542	missense	probably benign	0.01
R1587:Ldlr	UTSW	9	21737913	missense	probably damaging	0.99
R2198:Ldlr	UTSW	9	21732402	missense	probably damaging	1.00
R3730:Ldlr	UTSW	9	21731801	missense	probably benign	0.09
R4422:Ldlr	UTSW	9	21737952	missense	probably damaging	1.00
R5044:Ldlr	UTSW	9	21735242	missense	probably benign	0.00
R5046:Ldlr	UTSW	9	21745907	critical splice donor site	probably null
R6186:Ldlr	UTSW	9	21723759	start gained	probably benign
R6195:Ldlr	UTSW	9	21731781	nonsense	probably null
R6682:Ldlr	UTSW	9	21732375	missense	probably benign
R7256:Ldlr	UTSW	9	21745744	missense	probably benign	0.01
R7384:Ldlr	UTSW	9	21739794	missense	probably benign	0.07
R7823:Ldlr	UTSW	9	21742306	critical splice donor site	probably null
R8065:Ldlr	UTSW	9	21737945	missense	probably damaging	1.00
R8223:Ldlr	UTSW	9	21747250	missense	probably damaging	1.00
R8732:Ldlr	UTSW	9	21739689	missense	probably benign	0.00
R8931:Ldlr	UTSW	9	21731812	missense	probably damaging	0.99
R8954:Ldlr	UTSW	9	21739532	missense	possibly damaging	0.87
R9315:Ldlr	UTSW	9	21733486	splice site	probably benign
R9489:Ldlr	UTSW	9	21735330	missense	probably damaging	1.00
R9517:Ldlr	UTSW	9	21743944	missense	possibly damaging	0.90
R9605:Ldlr	UTSW	9	21735330	missense	probably damaging	1.00
R9709:Ldlr	UTSW	9	21745839	missense	probably benign	0.00
X0024:Ldlr	UTSW	9	21739818	missense	probably damaging	1.00
Z1177:Ldlr	UTSW	9	21739830	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAACATTAACTTCCTGTCTGCCTG -3'
(R):5'- GCGAGCCTTTTACATGCTGC -3'

Sequencing Primer
(F):5'- TCAGTGACAGAGCACTTGTC -3'
(R):5'- TTACATGCTGCGGGGGC -3'

Posted On

2018-06-06