Mutagenetix > Incidental Mutation

Incidental Mutation 'R8223:Ldlr'

636831

Institutional Source

Beutler Lab

Gene Symbol

Ldlr

Ensembl Gene

ENSMUSG00000032193

Gene Name

low density lipoprotein receptor

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8223 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

21723483-21749919 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21747250 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 833 (T833A)

Ref Sequence

ENSEMBL: ENSMUSP00000034713 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034713]

AlphaFold

P35951

Predicted Effect

probably damaging
Transcript: ENSMUST00000034713
AA Change: T833A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034713
Gene: ENSMUSG00000032193
AA Change: T833A

Domain	Start	End	E-Value	Type
low complexity region	13	23	N/A	INTRINSIC
LDLa	26	65	1.89e-14	SMART
LDLa	67	106	9.81e-13	SMART
EGF_like	108	144	6.81e1	SMART
LDLa	108	145	3.77e-14	SMART
LDLa	147	186	6.67e-15	SMART
LDLa	197	234	1.16e-14	SMART
LDLa	236	273	3.24e-13	SMART
LDLa	276	316	1e-9	SMART
EGF	318	354	3.2e-4	SMART
EGF_CA	355	394	4.09e-11	SMART
LY	420	462	1.11e-3	SMART
LY	466	508	4.7e-11	SMART
LY	509	552	5.23e-9	SMART
LY	553	595	7.86e-13	SMART
LY	596	639	3.25e-5	SMART
EGF	666	713	7.64e-2	SMART
low complexity region	799	811	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. Low density lipoprotein (LDL) is normally bound at the cell membrane and taken into the cell ending up in lysosomes where the protein is degraded and the cholesterol is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous targeted mutants exhibit 2X higher total plasma cholesterol and 7-9X higher IDL and LDL levels on a normal diet compared to controls. On a high cholesterol diet, mutant effects dramatically increase and mice develop xanthomatosis and atherosclerosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgre1	T	A	17: 57,361,692	W18R	probably damaging	Het
Alms1	T	A	6: 85,643,240	Y2417*	probably null	Het
Apold1	T	A	6: 134,984,185	S201T	probably benign	Het
Arhgap31	G	A	16: 38,603,722	P661S	probably benign	Het
BC080695	T	G	4: 143,571,960	Y158D	probably benign	Het
Cacfd1	T	C	2: 27,018,384	V110A	possibly damaging	Het
Capn2	A	G	1: 182,482,534		probably null	Het
Chadl	T	C	15: 81,695,134	E98G	possibly damaging	Het
Crxos	T	C	7: 15,897,469	Y31H	probably benign	Het
Cyp4f14	A	C	17: 32,911,653		probably null	Het
Cyp4f39	T	C	17: 32,470,865	I95T	probably benign	Het
Dars	T	C	1: 128,372,224	E341G	probably benign	Het
Dchs1	G	T	7: 105,762,617	R1431S	possibly damaging	Het
Dopey1	T	A	9: 86,518,292	H1001Q	probably damaging	Het
Efemp1	T	C	11: 28,854,528	Y19H	probably benign	Het
Eml1	T	G	12: 108,536,310	F726V	probably benign	Het
Fdx1	A	T	9: 51,948,621	D136E	probably benign	Het
Ganab	A	T	19: 8,910,828	D446V	probably damaging	Het
Gusb	A	G	5: 129,990,112	V561A	probably benign	Het
Hcn1	A	T	13: 117,873,870	D328V	unknown	Het
Hdgfl1	A	G	13: 26,770,064	Y9H	probably damaging	Het
Hes3	T	A	4: 152,287,115	S101C	probably damaging	Het
Igkv2-112	T	C	6: 68,220,595	S84P	probably benign	Het
Ints9	C	T	14: 65,020,360	P330S	possibly damaging	Het
Kdm7a	A	T	6: 39,149,301	N583K	probably damaging	Het
Klhl10	C	T	11: 100,447,401	T322M	probably damaging	Het
Kmt2c	A	T	5: 25,324,218	V1545D	possibly damaging	Het
Laptm5	T	C	4: 130,926,200		probably null	Het
Llgl1	G	T	11: 60,702,822	L40F	possibly damaging	Het
Lrrc14	T	C	15: 76,714,556	L464S	probably damaging	Het
Lrrc38	G	A	4: 143,350,733	G189R	probably damaging	Het
Lysmd3	T	A	13: 81,669,267	L121H		Het
Map2	T	C	1: 66,425,490	S1680P	probably damaging	Het
Med12l	T	C	3: 59,086,363	V583A	possibly damaging	Het
Mfsd4b5	A	G	10: 39,970,250	Y445H	probably damaging	Het
Morf4l1	G	A	9: 90,097,422	P169S	probably benign	Het
Nab2	C	A	10: 127,662,776	V475L	probably benign	Het
Ola1	A	G	2: 73,099,350	L303P	probably damaging	Het
Olfr1501	G	T	19: 13,838,861	T104K	probably damaging	Het
Olfr348	T	A	2: 36,787,397	Y291N		Het
Olfr857	T	C	9: 19,713,409	I194T	probably benign	Het
Olfr97	T	C	17: 37,231,836	D178G	possibly damaging	Het
Pdlim3	A	T	8: 45,900,525	H99L	possibly damaging	Het
Plagl2	G	T	2: 153,231,541	T480N	probably benign	Het
Ptprq	C	T	10: 107,699,638	R422Q	probably benign	Het
Rad18	T	A	6: 112,688,021	R51*	probably null	Het
Rpap3	T	A	15: 97,691,304	T250S	probably benign	Het
Serpinb11	T	C	1: 107,377,532	Y213H	probably benign	Het
Slc15a4	A	G	5: 127,609,016	F201L	possibly damaging	Het
Slc25a4	A	G	8: 46,210,859	S22P	probably damaging	Het
Slfn1	T	A	11: 83,121,419	N120K	probably damaging	Het
Smok3c	T	C	5: 138,065,393	S381P	probably benign	Het
Sry	T	A	Y: 2,663,204	Q152L	unknown	Het
Taar2	T	A	10: 23,941,350	W263R	probably damaging	Het
Thnsl1	T	A	2: 21,212,113	V226E	probably benign	Het
Tmeff2	T	C	1: 51,133,120		probably null	Het
Tox	A	G	4: 6,842,408	Y41H	probably damaging	Het
Trank1	T	A	9: 111,365,889	Y994N	probably damaging	Het
Trim9	C	T	12: 70,251,015	A713T	probably damaging	Het
Tub	T	A	7: 109,029,326	M393K	probably benign	Het
Ube4a	A	G	9: 44,960,035	L22P	possibly damaging	Het
Usp47	A	G	7: 112,104,376	K1165R	probably damaging	Het
Usp6nl	T	A	2: 6,430,516	I362K	probably damaging	Het
Vmn1r217	T	C	13: 23,114,199	I178V	probably benign	Het
Vmn1r45	T	A	6: 89,933,092	T299S	probably damaging	Het
Vmn2r5	A	T	3: 64,491,305	L751*	probably null	Het
Xkr8	G	A	4: 132,730,935	P144L	probably damaging	Het
Zfpm2	T	C	15: 40,752,959	I35T	probably benign	Het

Other mutations in Ldlr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Ldlr	APN	9	21735361	critical splice donor site	probably null
IGL01975:Ldlr	APN	9	21733697	missense	probably benign	0.05
IGL02043:Ldlr	APN	9	21733499	missense	probably benign	0.03
IGL02524:Ldlr	APN	9	21733681	missense	probably damaging	1.00
IGL03049:Ldlr	APN	9	21745819	missense	probably benign	0.00
IGL03113:Ldlr	APN	9	21739828	missense	possibly damaging	0.85
R0240:Ldlr	UTSW	9	21737999	splice site	probably benign
R0586:Ldlr	UTSW	9	21739744	missense	probably benign	0.00
R1398:Ldlr	UTSW	9	21739542	missense	probably benign	0.01
R1587:Ldlr	UTSW	9	21737913	missense	probably damaging	0.99
R2198:Ldlr	UTSW	9	21732402	missense	probably damaging	1.00
R3730:Ldlr	UTSW	9	21731801	missense	probably benign	0.09
R4422:Ldlr	UTSW	9	21737952	missense	probably damaging	1.00
R5044:Ldlr	UTSW	9	21735242	missense	probably benign	0.00
R5046:Ldlr	UTSW	9	21745907	critical splice donor site	probably null
R6186:Ldlr	UTSW	9	21723759	start gained	probably benign
R6195:Ldlr	UTSW	9	21731781	nonsense	probably null
R6523:Ldlr	UTSW	9	21737253	missense	probably damaging	1.00
R6682:Ldlr	UTSW	9	21732375	missense	probably benign
R7256:Ldlr	UTSW	9	21745744	missense	probably benign	0.01
R7384:Ldlr	UTSW	9	21739794	missense	probably benign	0.07
R7823:Ldlr	UTSW	9	21742306	critical splice donor site	probably null
R8065:Ldlr	UTSW	9	21737945	missense	probably damaging	1.00
R8732:Ldlr	UTSW	9	21739689	missense	probably benign	0.00
R8931:Ldlr	UTSW	9	21731812	missense	probably damaging	0.99
R8954:Ldlr	UTSW	9	21739532	missense	possibly damaging	0.87
R9315:Ldlr	UTSW	9	21733486	splice site	probably benign
R9489:Ldlr	UTSW	9	21735330	missense	probably damaging	1.00
R9517:Ldlr	UTSW	9	21743944	missense	possibly damaging	0.90
R9605:Ldlr	UTSW	9	21735330	missense	probably damaging	1.00
R9709:Ldlr	UTSW	9	21745839	missense	probably benign	0.00
X0024:Ldlr	UTSW	9	21739818	missense	probably damaging	1.00
Z1177:Ldlr	UTSW	9	21739830	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATGGACATGCCGGTAGCTTC -3'
(R):5'- AGCTGGCTCTAGCATGTTC -3'

Sequencing Primer
(F):5'- ACATGCCGGTAGCTTCACTGG -3'
(R):5'- CCTAGGCAGGTTCTACCACTGAG -3'

Posted On

2020-07-13