Mutagenetix > Incidental Mutation

Incidental Mutation 'R6558:Htr7'

522282

Institutional Source

Beutler Lab

Gene Symbol

Htr7

Ensembl Gene

ENSMUSG00000024798

Gene Name

5-hydroxytryptamine (serotonin) receptor 7

Synonyms

5-HT7

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6558 (G1)

Quality Score

86.0507

Status

Not validated

Chromosome

Chromosomal Location

35958734-36057507 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 36057240 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 5 (N5S)

Ref Sequence

ENSEMBL: ENSMUSP00000128386 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099505] [ENSMUST00000164639] [ENSMUST00000164781] [ENSMUST00000165215] [ENSMUST00000166074] [ENSMUST00000170360]

AlphaFold

P32304

Predicted Effect

probably damaging
Transcript: ENSMUST00000099505
AA Change: N5S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000097105
Gene: ENSMUSG00000024798
AA Change: N5S

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srsx	95	402	2.3e-9	PFAM
Pfam:7tm_1	101	387	4.8e-75	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000164639
AA Change: N5S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000126847
Gene: ENSMUSG00000024798
AA Change: N5S

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srsx	95	402	1.3e-9	PFAM
Pfam:7tm_1	101	387	1.7e-82	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000164781
AA Change: N5S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131912
Gene: ENSMUSG00000024798
AA Change: N5S

Domain	Start	End	E-Value	Type
low complexity region	90	99	N/A	INTRINSIC
Pfam:7tm_1	101	185	2.8e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000165215
AA Change: N5S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000128386
Gene: ENSMUSG00000024798
AA Change: N5S

Domain	Start	End	E-Value	Type
low complexity region	90	99	N/A	INTRINSIC
Pfam:7tm_1	101	183	7.1e-30	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000166074
AA Change: N5S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000126150
Gene: ENSMUSG00000024798
AA Change: N5S

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srsx	95	402	2.7e-9	PFAM
Pfam:7tm_1	101	387	5.6e-82	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000170360
AA Change: N5S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000131517
Gene: ENSMUSG00000024798
AA Change: N5S

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srsx	95	247	9.6e-9	PFAM
Pfam:7tm_1	101	252	1.4e-49	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.6%

Validation Efficiency

100% (31/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The neurotransmitter, serotonin, is thought to play a role in various cognitive and behavioral functions. The serotonin receptor encoded by this gene belongs to the superfamily of G protein-coupled receptors and the gene is a candidate locus for involvement in autistic disorder and other neuropsychiatric disorders. Three splice variants have been identified which encode proteins that differ in the length of their carboxy terminal ends. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display lower electrically- and chemically-induced seizure thresholds. Mice homozygous for a different knock-out allele show enhanced coordination and higher thermal nociceptive thresholds. Other nullizygous mutantsfail to exhibit agonist-induced hypothermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahi1	T	C	10: 20,963,673	V161A	probably damaging	Het
Anxa3	A	G	5: 96,812,939		probably null	Het
Cftr	T	C	6: 18,222,528	I261T	probably damaging	Het
Chml	A	T	1: 175,687,182	M391K	probably damaging	Het
Cog2	T	C	8: 124,550,232	L659P	probably damaging	Het
Col5a3	C	T	9: 20,779,033	G1162R	probably damaging	Het
Cxcl2	T	C	5: 90,904,365	L71P	probably damaging	Het
Cxcl5	A	G	5: 90,759,818	E83G	probably damaging	Het
Dpt	A	G	1: 164,796,811	Y27C	unknown	Het
Drc3	A	T	11: 60,364,892	I102F	probably damaging	Het
Fam83h	T	C	15: 76,004,453	D345G	probably damaging	Het
Gm14412	G	T	2: 177,314,554	T516K	probably damaging	Het
Grip1	A	G	10: 119,454,383	N7D	probably benign	Het
Hoxc11	T	C	15: 102,954,866	L114P	probably damaging	Het
Ifi208	C	T	1: 173,683,023	T248I	probably damaging	Het
Lrrc71	G	A	3: 87,742,643	T326M	probably benign	Het
Map7d1	G	A	4: 126,232,909	A798V	unknown	Het
Mfsd13a	T	A	19: 46,366,478	N31K	probably damaging	Het
Myadm	T	A	7: 3,297,061	I113N	probably damaging	Het
Myo18a	A	G	11: 77,850,852	E1509G	probably damaging	Het
Nalcn	C	G	14: 123,486,507	R382P	probably benign	Het
Ogfr	C	T	2: 180,595,404	P594L	possibly damaging	Het
Olfr458	T	A	6: 42,460,777	M81L	probably benign	Het
Olfr508	T	A	7: 108,630,188	H65Q	probably damaging	Het
Pkd1l1	C	T	11: 8,889,052	M877I	probably benign	Het
Sec23a	A	T	12: 59,004,552	S102T	probably benign	Het
Stoml1	T	A	9: 58,256,668	V90E	probably damaging	Het
Stra8	G	A	6: 34,933,040	W111*	probably null	Het
Timeless	T	A	10: 128,249,563	V850D	probably benign	Het
Unc5c	A	T	3: 141,789,729	D453V	probably damaging	Het
Xdh	T	G	17: 73,893,713	T1138P	possibly damaging	Het
Zkscan6	A	T	11: 65,828,225	H357L	probably benign	Het

Other mutations in Htr7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02683:Htr7	APN	19	35960362	missense	probably benign	0.00
R0009:Htr7	UTSW	19	36041540	intron	probably benign
R0318:Htr7	UTSW	19	35969486	missense	probably damaging	1.00
R1695:Htr7	UTSW	19	35969736	missense	probably benign	0.01
R2316:Htr7	UTSW	19	35969303	critical splice donor site	probably null
R3973:Htr7	UTSW	19	36056760	missense	probably damaging	1.00
R5041:Htr7	UTSW	19	36057067	missense	probably benign	0.10
R5203:Htr7	UTSW	19	35964392	missense	probably benign	0.00
R5236:Htr7	UTSW	19	36056769	missense	probably damaging	1.00
R5538:Htr7	UTSW	19	35969835	missense	probably benign	0.34
R5682:Htr7	UTSW	19	35969871	missense	probably damaging	1.00
R5683:Htr7	UTSW	19	35969871	missense	probably damaging	1.00
R5684:Htr7	UTSW	19	35969871	missense	probably damaging	1.00
R5686:Htr7	UTSW	19	35969871	missense	probably damaging	1.00
R5694:Htr7	UTSW	19	36057121	missense	probably benign	0.00
R6273:Htr7	UTSW	19	36041569	intron	probably benign
R6502:Htr7	UTSW	19	35969610	missense	probably damaging	1.00
R6884:Htr7	UTSW	19	35964379	critical splice donor site	probably null
R7074:Htr7	UTSW	19	36056883	missense	probably damaging	0.99
R7592:Htr7	UTSW	19	36056892	missense	probably damaging	1.00
R9067:Htr7	UTSW	19	36057090	missense	probably benign
R9338:Htr7	UTSW	19	35964380	critical splice donor site	probably null
R9783:Htr7	UTSW	19	35969387	missense	probably damaging	1.00
X0064:Htr7	UTSW	19	36056755	missense	possibly damaging	0.70
Z1176:Htr7	UTSW	19	35969423	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATAGTTGATCTGCTCCCCGC -3'
(R):5'- TTTGCTACAGTGCTGAGGC -3'

Sequencing Primer
(F):5'- GCAGCCGGAGACATTGTC -3'
(R):5'- CGCACTCCGCAACTTCG -3'

Posted On

2018-06-06