Incidental Mutation 'R6564:Bpifb9a'
ID522303
Institutional Source Beutler Lab
Gene Symbol Bpifb9a
Ensembl Gene ENSMUSG00000067998
Gene NameBPI fold containing family B, member 9A
Synonyms4833413D08Rik, vomeromodulin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6564 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location154257854-154271245 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 154260178 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 65 (V65A)
Ref Sequence ENSEMBL: ENSMUSP00000086314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088924]
Predicted Effect probably benign
Transcript: ENSMUST00000088924
AA Change: V65A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000086314
Gene: ENSMUSG00000067998
AA Change: V65A

DomainStartEndE-ValueType
low complexity region 60 77 N/A INTRINSIC
low complexity region 122 157 N/A INTRINSIC
low complexity region 167 181 N/A INTRINSIC
low complexity region 184 203 N/A INTRINSIC
Pfam:LBP_BPI_CETP 216 377 1.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147299
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,486,077 probably null Het
4931429L15Rik C A 9: 46,306,904 D179Y probably damaging Het
Abca1 A T 4: 53,034,031 L2233Q possibly damaging Het
Abca12 T A 1: 71,309,850 E834V possibly damaging Het
Abcc9 T C 6: 142,603,108 Y1318C probably damaging Het
Adam15 C A 3: 89,347,212 R121L possibly damaging Het
Afdn T A 17: 13,896,089 M1588K probably benign Het
Akap9 T C 5: 4,028,491 S1849P probably damaging Het
Bag6 T C 17: 35,140,371 S213P probably damaging Het
Chn1 T A 2: 73,618,041 I203F probably damaging Het
Crnkl1 T A 2: 145,928,245 E226V possibly damaging Het
Cspg4 A G 9: 56,890,158 E1302G probably benign Het
Dnah5 G T 15: 28,367,745 A2759S probably benign Het
Doxl2 T C 6: 48,977,575 V549A probably benign Het
Dtx1 T A 5: 120,695,017 T119S probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ezr C T 17: 6,742,847 V268M probably damaging Het
Fbxl15 T C 19: 46,329,338 V153A probably damaging Het
Fkbpl C A 17: 34,646,266 A336E probably benign Het
Gsg1l2 A G 11: 67,786,504 T200A possibly damaging Het
H2afx T C 9: 44,334,912 Y51H probably damaging Het
Ifi213 A C 1: 173,595,296 M1R probably null Het
Kcnt1 A C 2: 25,911,051 D1045A probably benign Het
Kdm4a C A 4: 118,177,439 A32S probably benign Het
Klkb1 A T 8: 45,273,634 V444E probably damaging Het
Mccc1 T C 3: 35,976,676 T414A probably damaging Het
Miga1 A C 3: 152,285,322 N367K probably damaging Het
Mmp7 A G 9: 7,695,184 D49G probably benign Het
Nlrp1a A G 11: 71,123,572 L284P probably damaging Het
Olfr1411 T C 1: 92,596,563 S15P probably benign Het
Olfr853 G A 9: 19,537,210 T240I possibly damaging Het
Pbld1 T A 10: 63,072,027 I224N possibly damaging Het
Pih1d1 A T 7: 45,159,819 R276W probably damaging Het
Plekhg1 G T 10: 3,964,153 V1292L probably damaging Het
Prex2 A G 1: 11,101,061 probably null Het
Rbm6 T C 9: 107,833,498 Y498C probably damaging Het
Reps1 T A 10: 18,122,392 probably null Het
Ruvbl1 T A 6: 88,479,226 I154N possibly damaging Het
Slc4a5 T G 6: 83,280,060 F616V possibly damaging Het
Spag5 A T 11: 78,315,575 T798S probably damaging Het
Spam1 T A 6: 24,796,356 I102K possibly damaging Het
Sptbn2 C A 19: 4,732,024 F430L probably damaging Het
Svs3a T A 2: 164,289,350 I21K probably damaging Het
Tet3 T A 6: 83,386,070 I842L possibly damaging Het
Tlr2 T A 3: 83,837,695 K360N probably benign Het
Tmem45b C G 9: 31,428,005 W138S probably damaging Het
Tpgs2 T C 18: 25,158,287 E40G probably damaging Het
Traj40 T C 14: 54,177,942 probably benign Het
Trpm5 A G 7: 143,072,770 S125P probably damaging Het
Ttc3 G T 16: 94,442,611 C1158F probably damaging Het
Tubg1 T C 11: 101,120,889 I74T probably damaging Het
Vav2 A T 2: 27,279,185 probably null Het
Wbp4 G T 14: 79,467,428 H201N probably damaging Het
Wdhd1 A G 14: 47,248,042 S821P probably benign Het
Wsb2 A T 5: 117,370,560 probably null Het
Zic5 A G 14: 122,459,421 L594P unknown Het
Other mutations in Bpifb9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Bpifb9a APN 2 154264275 nonsense probably null
IGL00899:Bpifb9a APN 2 154264727 splice site probably null
IGL01998:Bpifb9a APN 2 154268200 critical splice donor site probably null
IGL02158:Bpifb9a APN 2 154266813 splice site probably benign
IGL02331:Bpifb9a APN 2 154262387 missense possibly damaging 0.45
R0066:Bpifb9a UTSW 2 154266841 missense possibly damaging 0.95
R0480:Bpifb9a UTSW 2 154264688 missense probably benign 0.33
R0545:Bpifb9a UTSW 2 154261950 nonsense probably null
R0904:Bpifb9a UTSW 2 154264225 splice site probably benign
R1028:Bpifb9a UTSW 2 154262407 missense possibly damaging 0.45
R1158:Bpifb9a UTSW 2 154262264 missense probably benign 0.08
R1465:Bpifb9a UTSW 2 154271021 missense possibly damaging 0.85
R1465:Bpifb9a UTSW 2 154271021 missense possibly damaging 0.85
R1902:Bpifb9a UTSW 2 154261991 missense probably benign 0.00
R2015:Bpifb9a UTSW 2 154268200 critical splice donor site probably null
R2152:Bpifb9a UTSW 2 154260135 missense probably benign 0.28
R2206:Bpifb9a UTSW 2 154264241 synonymous probably null
R5410:Bpifb9a UTSW 2 154270235 missense probably benign 0.05
R5731:Bpifb9a UTSW 2 154262243 missense possibly damaging 0.87
R5818:Bpifb9a UTSW 2 154262295 missense probably damaging 0.98
R5865:Bpifb9a UTSW 2 154266836 missense probably benign 0.26
R7291:Bpifb9a UTSW 2 154267696 missense probably damaging 1.00
R7294:Bpifb9a UTSW 2 154267696 missense probably damaging 1.00
R7295:Bpifb9a UTSW 2 154267696 missense probably damaging 1.00
R7453:Bpifb9a UTSW 2 154264695 missense probably damaging 0.99
R7570:Bpifb9a UTSW 2 154262263 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- AGGCCTTGGCCATCATGTTG -3'
(R):5'- TCTCTAGGCCCCAAGTAGATG -3'

Sequencing Primer
(F):5'- TCATGTTGAGCATCCAAGCG -3'
(R):5'- TCTAGGCCCCAAGTAGATGTTACAG -3'
Posted On2018-06-06