Incidental Mutation 'R6564:Abca1'
ID522312
Institutional Source Beutler Lab
Gene Symbol Abca1
Ensembl Gene ENSMUSG00000015243
Gene NameATP-binding cassette, sub-family A (ABC1), member 1
SynonymsABC1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6564 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location53030787-53159895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53034031 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 2233 (L2233Q)
Ref Sequence ENSEMBL: ENSMUSP00000030010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030010]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030010
AA Change: L2233Q

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243
AA Change: L2233Q

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ABC2_membrane_3 395 841 4.9e-14 PFAM
AAA 925 1122 4.2e-10 SMART
low complexity region 1137 1150 N/A INTRINSIC
Pfam:ABC2_membrane_3 1344 1869 1.7e-53 PFAM
low complexity region 1890 1899 N/A INTRINSIC
AAA 1938 2123 3.04e-7 SMART
low complexity region 2176 2187 N/A INTRINSIC
low complexity region 2222 2237 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149127
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Many homozygous null mutants die perinatally with placental defects. Survivors show altered steroidogenesis, defective lipid export in Golgi, low serum cholesterol, lipid accumulation in macrophages and lung, reduced fertility and kidney and heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,486,077 probably null Het
4931429L15Rik C A 9: 46,306,904 D179Y probably damaging Het
Abca12 T A 1: 71,309,850 E834V possibly damaging Het
Abcc9 T C 6: 142,603,108 Y1318C probably damaging Het
Adam15 C A 3: 89,347,212 R121L possibly damaging Het
Afdn T A 17: 13,896,089 M1588K probably benign Het
Akap9 T C 5: 4,028,491 S1849P probably damaging Het
Bag6 T C 17: 35,140,371 S213P probably damaging Het
Bpifb9a T C 2: 154,260,178 V65A probably benign Het
Chn1 T A 2: 73,618,041 I203F probably damaging Het
Crnkl1 T A 2: 145,928,245 E226V possibly damaging Het
Cspg4 A G 9: 56,890,158 E1302G probably benign Het
Dnah5 G T 15: 28,367,745 A2759S probably benign Het
Doxl2 T C 6: 48,977,575 V549A probably benign Het
Dtx1 T A 5: 120,695,017 T119S probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ezr C T 17: 6,742,847 V268M probably damaging Het
Fbxl15 T C 19: 46,329,338 V153A probably damaging Het
Fkbpl C A 17: 34,646,266 A336E probably benign Het
Gsg1l2 A G 11: 67,786,504 T200A possibly damaging Het
H2afx T C 9: 44,334,912 Y51H probably damaging Het
Ifi213 A C 1: 173,595,296 M1R probably null Het
Kcnt1 A C 2: 25,911,051 D1045A probably benign Het
Kdm4a C A 4: 118,177,439 A32S probably benign Het
Klkb1 A T 8: 45,273,634 V444E probably damaging Het
Mccc1 T C 3: 35,976,676 T414A probably damaging Het
Miga1 A C 3: 152,285,322 N367K probably damaging Het
Mmp7 A G 9: 7,695,184 D49G probably benign Het
Nlrp1a A G 11: 71,123,572 L284P probably damaging Het
Olfr1411 T C 1: 92,596,563 S15P probably benign Het
Olfr853 G A 9: 19,537,210 T240I possibly damaging Het
Pbld1 T A 10: 63,072,027 I224N possibly damaging Het
Pih1d1 A T 7: 45,159,819 R276W probably damaging Het
Plekhg1 G T 10: 3,964,153 V1292L probably damaging Het
Prex2 A G 1: 11,101,061 probably null Het
Rbm6 T C 9: 107,833,498 Y498C probably damaging Het
Reps1 T A 10: 18,122,392 probably null Het
Ruvbl1 T A 6: 88,479,226 I154N possibly damaging Het
Slc4a5 T G 6: 83,280,060 F616V possibly damaging Het
Spag5 A T 11: 78,315,575 T798S probably damaging Het
Spam1 T A 6: 24,796,356 I102K possibly damaging Het
Sptbn2 C A 19: 4,732,024 F430L probably damaging Het
Svs3a T A 2: 164,289,350 I21K probably damaging Het
Tet3 T A 6: 83,386,070 I842L possibly damaging Het
Tlr2 T A 3: 83,837,695 K360N probably benign Het
Tmem45b C G 9: 31,428,005 W138S probably damaging Het
Tpgs2 T C 18: 25,158,287 E40G probably damaging Het
Traj40 T C 14: 54,177,942 probably benign Het
Trpm5 A G 7: 143,072,770 S125P probably damaging Het
Ttc3 G T 16: 94,442,611 C1158F probably damaging Het
Tubg1 T C 11: 101,120,889 I74T probably damaging Het
Vav2 A T 2: 27,279,185 probably null Het
Wbp4 G T 14: 79,467,428 H201N probably damaging Het
Wdhd1 A G 14: 47,248,042 S821P probably benign Het
Wsb2 A T 5: 117,370,560 probably null Het
Zic5 A G 14: 122,459,421 L594P unknown Het
Other mutations in Abca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca1 APN 4 53059255 critical splice donor site probably null
IGL00778:Abca1 APN 4 53086132 missense probably benign
IGL01013:Abca1 APN 4 53038185 nonsense probably null
IGL01510:Abca1 APN 4 53143979 missense probably damaging 0.97
IGL01608:Abca1 APN 4 53038158 missense probably damaging 1.00
IGL01845:Abca1 APN 4 53090297 missense probably damaging 1.00
IGL02048:Abca1 APN 4 53069831 missense probably damaging 1.00
IGL02249:Abca1 APN 4 53068739 nonsense probably null
IGL02569:Abca1 APN 4 53034061 missense probably damaging 1.00
IGL02622:Abca1 APN 4 53034046 missense probably damaging 0.99
R6720_abca1_529 UTSW 4 53083733 missense probably damaging 1.00
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0050:Abca1 UTSW 4 53069910 splice site probably benign
R0107:Abca1 UTSW 4 53080834 missense probably benign 0.00
R0127:Abca1 UTSW 4 53067155 missense probably benign 0.00
R0178:Abca1 UTSW 4 53081953 missense possibly damaging 0.89
R0207:Abca1 UTSW 4 53086039 missense probably damaging 0.97
R0267:Abca1 UTSW 4 53046105 missense probably damaging 1.00
R0269:Abca1 UTSW 4 53044228 missense probably benign
R0586:Abca1 UTSW 4 53092860 missense probably benign 0.00
R0587:Abca1 UTSW 4 53107035 missense probably benign 0.00
R1403:Abca1 UTSW 4 53059253 splice site probably benign
R1404:Abca1 UTSW 4 53059253 splice site probably benign
R1405:Abca1 UTSW 4 53059253 splice site probably benign
R1558:Abca1 UTSW 4 53092887 missense probably null 0.00
R1655:Abca1 UTSW 4 53050964 missense probably benign
R1662:Abca1 UTSW 4 53090251 splice site probably null
R1769:Abca1 UTSW 4 53074325 missense probably damaging 1.00
R1898:Abca1 UTSW 4 53071977 missense probably benign 0.08
R1945:Abca1 UTSW 4 53061509 frame shift probably null
R1966:Abca1 UTSW 4 53050409 missense probably damaging 1.00
R2055:Abca1 UTSW 4 53069881 missense probably benign
R2185:Abca1 UTSW 4 53089830 missense probably benign 0.12
R2202:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2203:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2204:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R3056:Abca1 UTSW 4 53127626 missense probably benign
R3849:Abca1 UTSW 4 53061481 splice site probably benign
R3850:Abca1 UTSW 4 53061481 splice site probably benign
R3906:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R3908:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R4050:Abca1 UTSW 4 53044144 missense probably damaging 1.00
R4204:Abca1 UTSW 4 53090369 missense probably benign 0.00
R4225:Abca1 UTSW 4 53085106 missense possibly damaging 0.87
R4577:Abca1 UTSW 4 53062568 missense possibly damaging 0.94
R4979:Abca1 UTSW 4 53085092 splice site probably null
R5022:Abca1 UTSW 4 53041570 frame shift probably null
R5168:Abca1 UTSW 4 53086070 missense probably benign
R5363:Abca1 UTSW 4 53132963 missense probably benign 0.00
R5439:Abca1 UTSW 4 53042381 missense possibly damaging 0.55
R5604:Abca1 UTSW 4 53067168 splice site probably null
R5614:Abca1 UTSW 4 53046132 missense probably damaging 1.00
R5810:Abca1 UTSW 4 53079631 missense probably benign
R6001:Abca1 UTSW 4 53075555 missense possibly damaging 0.68
R6151:Abca1 UTSW 4 53085261 missense probably benign
R6185:Abca1 UTSW 4 53078089 missense probably benign 0.31
R6262:Abca1 UTSW 4 53092917 missense probably benign 0.01
R6455:Abca1 UTSW 4 53042376 missense probably damaging 0.98
R6472:Abca1 UTSW 4 53085991 critical splice donor site probably null
R6720:Abca1 UTSW 4 53083733 missense probably damaging 1.00
R6903:Abca1 UTSW 4 53143952 missense probably benign 0.17
R6960:Abca1 UTSW 4 53072924 missense probably benign 0.00
R7065:Abca1 UTSW 4 53074233 missense probably damaging 0.98
R7142:Abca1 UTSW 4 53082050 missense probably damaging 1.00
R7322:Abca1 UTSW 4 53067151 missense probably damaging 0.97
R7520:Abca1 UTSW 4 53078114 missense probably benign
R7547:Abca1 UTSW 4 53109269 missense probably benign 0.02
X0023:Abca1 UTSW 4 53049038 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCTTTCTTCTAGAACACTTGACAC -3'
(R):5'- TCTGTGCTTCTCGAGAGCTC -3'

Sequencing Primer
(F):5'- TCTTCTAGAACACTTGACACAGTGC -3'
(R):5'- CATGGGGGATTTCTCCTTCAAGTAC -3'
Posted On2018-06-06