Incidental Mutation 'R6562:Gm17067'
ID522453
Institutional Source Beutler Lab
Gene Symbol Gm17067
Ensembl Gene ENSMUSG00000091594
Gene Namepredicted gene 17067
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6562 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location42705469-42727017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42708729 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 116 (S116R)
Ref Sequence ENSEMBL: ENSMUSP00000128086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166837] [ENSMUST00000180131]
Predicted Effect probably damaging
Transcript: ENSMUST00000166837
AA Change: S116R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128086
Gene: ENSMUSG00000091594
AA Change: S116R

DomainStartEndE-ValueType
KRAB 4 66 4.19e-17 SMART
ZnF_C2H2 131 153 1.28e-3 SMART
ZnF_C2H2 159 181 9.73e-4 SMART
ZnF_C2H2 187 209 1.03e-2 SMART
ZnF_C2H2 215 237 1.28e-3 SMART
ZnF_C2H2 243 265 1.38e-3 SMART
ZnF_C2H2 271 293 1.04e-3 SMART
ZnF_C2H2 299 321 8.47e-4 SMART
ZnF_C2H2 327 349 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180131
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,362 T1246S possibly damaging Het
4933434E20Rik A G 3: 90,063,236 K26E probably benign Het
Abt1 T G 13: 23,423,588 E82A probably damaging Het
Actr8 A G 14: 29,986,454 probably null Het
Akap12 G T 10: 4,356,141 E984* probably null Het
Ankrd13a C A 5: 114,804,392 probably benign Het
Ankrd13c T A 3: 157,999,672 S411T probably damaging Het
Arhgef28 A G 13: 97,988,139 probably null Het
Arhgef3 A T 14: 27,152,996 probably benign Het
Atad5 T C 11: 80,133,206 S1712P probably benign Het
Bbs12 A G 3: 37,320,240 E394G probably damaging Het
Ccdc158 T G 5: 92,662,722 K102N probably damaging Het
Ccdc169 A G 3: 55,150,814 N89S probably damaging Het
Cenpu T C 8: 46,572,823 I132T possibly damaging Het
Cnrip1 G A 11: 17,078,539 W157* probably null Het
Ctnnd1 A G 2: 84,624,308 S53P probably benign Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dock7 A T 4: 98,991,410 V969D probably damaging Het
Ehd2 C A 7: 15,957,567 R280L probably benign Het
Entpd5 T C 12: 84,386,200 T218A probably damaging Het
Fcrls A C 3: 87,257,328 I297S probably benign Het
Frmpd2 T A 14: 33,571,915 L1346Q probably benign Het
Fry T C 5: 150,326,149 S142P probably damaging Het
Gbgt1 A T 2: 28,504,886 I179F probably damaging Het
Gm5565 G T 5: 146,158,154 P261T probably damaging Het
Gm609 C T 16: 45,444,079 E39K probably benign Het
Kat6a T C 8: 22,911,787 F391L probably benign Het
Kcnmb4 A T 10: 116,473,184 probably null Het
Krt6a T A 15: 101,691,659 H386L probably benign Het
L3mbtl1 C T 2: 162,970,204 T723I probably benign Het
Lamb2 A T 9: 108,487,008 R1049W possibly damaging Het
Lrmda T C 14: 22,598,186 probably benign Het
Lysmd2 C T 9: 75,635,409 T95I unknown Het
Ndst3 A G 3: 123,552,532 S698P probably damaging Het
Nin T C 12: 70,055,954 D300G probably damaging Het
Nutf2 G T 8: 105,875,626 D23Y probably benign Het
Olfr801 G A 10: 129,670,139 P127S probably damaging Het
Ovgp1 A G 3: 105,980,273 Y300C probably damaging Het
Pgghg A G 7: 140,946,593 I633V probably benign Het
Pik3r3 C T 4: 116,299,809 Q496* probably null Het
Pkn3 G T 2: 30,080,687 probably null Het
Plin2 A T 4: 86,658,595 S298T probably benign Het
Prdm8 T C 5: 98,183,343 V18A possibly damaging Het
Rel C A 11: 23,757,026 G59* probably null Het
Siglecg A G 7: 43,409,057 R123G possibly damaging Het
Slc13a1 T A 6: 24,150,793 I49F probably benign Het
Slc39a10 T A 1: 46,835,564 T193S probably benign Het
Slc9a3 T A 13: 74,155,161 V191E probably damaging Het
Sult2b1 A C 7: 45,742,246 S39A probably benign Het
Tead1 A G 7: 112,861,443 T185A probably benign Het
Tmem67 A G 4: 12,053,445 probably null Het
Trim12c A T 7: 104,345,134 probably null Het
Trpm6 T A 19: 18,838,042 F1164Y probably damaging Het
Ube2d1 C T 10: 71,262,241 D16N probably benign Het
Vmn2r24 A T 6: 123,780,427 I85F probably benign Het
Vwde T A 6: 13,193,123 N406Y possibly damaging Het
Wdr54 A T 6: 83,155,068 probably null Het
Zcchc14 A T 8: 121,604,103 N840K probably damaging Het
Zfp451 C A 1: 33,762,179 S1052I possibly damaging Het
Other mutations in Gm17067
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03174:Gm17067 APN 7 42710676 critical splice donor site probably null
R0016:Gm17067 UTSW 7 42708622 missense probably benign 0.05
R0445:Gm17067 UTSW 7 42708622 missense probably benign 0.00
R3911:Gm17067 UTSW 7 42710680 missense possibly damaging 0.51
R4380:Gm17067 UTSW 7 42708038 missense probably benign 0.00
R5502:Gm17067 UTSW 7 42708419 missense probably damaging 0.97
R5557:Gm17067 UTSW 7 42708521 missense probably damaging 1.00
R5602:Gm17067 UTSW 7 42708415 missense probably damaging 0.98
R5875:Gm17067 UTSW 7 42708046 missense probably benign 0.00
R6016:Gm17067 UTSW 7 42708230 missense probably benign 0.24
R6029:Gm17067 UTSW 7 42708130 missense probably benign 0.06
R6360:Gm17067 UTSW 7 42708482 missense probably benign
R6892:Gm17067 UTSW 7 42710675 critical splice donor site probably null
Z1177:Gm17067 UTSW 7 42708298 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TACATTCATAGGGTTTCTCTCCAG -3'
(R):5'- TACATGTCCCCATTATCATTGCAG -3'

Sequencing Primer
(F):5'- ATAGGGTTTCTCTCCAGTATGC -3'
(R):5'- ATGTCCCCATTATCATTGCAGACATG -3'
Posted On2018-06-06