Incidental Mutation 'R6687:Mup12'
ID527822
Institutional Source Beutler Lab
Gene Symbol Mup12
Ensembl Gene ENSMUSG00000094793
Gene Namemajor urinary protein 12
SynonymsGm2024
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6687 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location60737383-60741326 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to C at 60741309 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117932]
PDB Structure
Thermodynamics of Binding of 2-methoxy-3-isopropylpyrazine and 2-methoxy-3-isobutylpyrazine to the Major Urinary Protein [X-RAY DIFFRACTION]
Thermodynamics of Binding of 2-methoxy-3-isopropylpyrazine and 2-methoxy-3-isobutylpyrazine to the Major Urinary Protein [X-RAY DIFFRACTION]
Thermodynamics of Binding of 2-methoxy-3-isopropylpyrazine and 2-methoxy-3-isobutylpyrazine to the Major Urinary Protein [X-RAY DIFFRACTION]
Van der Waals Interactions Dominate Hydrophobic Association in a Protein Binding Site Occluded From Solvent Water [X-RAY DIFFRACTION]
Van der Waals Interactions Dominate Hydrophobic Association in a Protein Binding Site Occluded From Solvent Water [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000117932
SMART Domains Protein: ENSMUSP00000112787
Gene: ENSMUSG00000094793

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Lipocalin 34 173 6e-34 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 T C 3: 151,542,755 V688A probably benign Het
AI661453 A G 17: 47,467,002 probably benign Het
Atp6ap1l A G 13: 90,886,723 F180S probably benign Het
Cfd G A 10: 79,891,719 V77M probably damaging Het
Col5a2 A T 1: 45,383,604 L1151H probably damaging Het
Dennd3 G A 15: 73,556,366 V854M possibly damaging Het
Dlg5 C T 14: 24,190,373 R247Q probably damaging Het
Fam3c G C 6: 22,328,670 P53A probably benign Het
Gpbp1 T C 13: 111,438,085 N302D possibly damaging Het
Hmcn1 A G 1: 150,745,033 V1142A probably benign Het
Ighv9-3 G A 12: 114,140,924 S40F probably damaging Het
Insr C T 8: 3,198,111 R478H probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Larp1 A G 11: 58,057,330 D985G probably damaging Het
Loxl3 A T 6: 83,050,664 H729L probably damaging Het
Lrrc14b T C 13: 74,360,762 M509V probably benign Het
Lrrc8e A G 8: 4,234,798 Y341C probably damaging Het
Mettl18 A G 1: 163,996,800 D230G possibly damaging Het
Myo1c T C 11: 75,672,201 S1020P probably benign Het
Olfr399 C A 11: 74,054,384 R125L probably damaging Het
Phkb T C 8: 86,029,546 I823T probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rpap2 T C 5: 107,603,630 probably null Het
Rpl38 T C 11: 114,668,768 probably benign Het
Scn8a T C 15: 100,974,627 F516L probably benign Het
Slc51a A T 16: 32,479,725 D71E probably damaging Het
Slco1a6 T C 6: 142,099,350 E470G possibly damaging Het
Spag17 C A 3: 100,092,950 H1811N probably benign Het
Sycp2 C T 2: 178,354,960 C1150Y probably damaging Het
Ttc12 A G 9: 49,438,418 V693A probably benign Het
Wdr83 C T 8: 85,080,149 V101I probably benign Het
Wnt3 G T 11: 103,812,585 R298L probably damaging Het
Other mutations in Mup12
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6366:Mup12 UTSW 4 60740658 missense probably damaging 0.98
R6676:Mup12 UTSW 4 60740643 splice site probably null
R7194:Mup12 UTSW 4 60740735 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CTGAGTCAGAAGCTACTATTCAGTG -3'
(R):5'- TTGCCAAGTTTGCAAAGGGC -3'

Sequencing Primer
(F):5'- CATTAAAGTTCCTTCCCGTAGAAC -3'
(R):5'- GGCAAGGAACAATTTTTCGCCTC -3'
Posted On2018-07-23