Incidental Mutation 'R6687:Slc51a'
ID527846
Institutional Source Beutler Lab
Gene Symbol Slc51a
Ensembl Gene ENSMUSG00000035699
Gene Namesolute carrier family 51, alpha subunit
SynonymsD630035O19Rik, Osta, OSTalpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R6687 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location32474504-32487879 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32479725 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 71 (D71E)
Ref Sequence ENSEMBL: ENSMUSP00000155959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042042] [ENSMUST00000079791] [ENSMUST00000231690]
Predicted Effect probably benign
Transcript: ENSMUST00000042042
AA Change: D71E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000046286
Gene: ENSMUSG00000035699
AA Change: D71E

DomainStartEndE-ValueType
Pfam:Solute_trans_a 53 321 2.7e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079791
SMART Domains Protein: ENSMUSP00000078721
Gene: ENSMUSG00000005615

DomainStartEndE-ValueType
Pfam:CTP_transf_2 80 208 6.4e-24 PFAM
low complexity region 244 262 N/A INTRINSIC
low complexity region 328 352 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231690
AA Change: D71E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232418
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (33/33)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene exhibit growth retardation. In addition, one mutant exhibits impaired intestinal bile acid transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 T C 3: 151,542,755 V688A probably benign Het
AI661453 A G 17: 47,467,002 probably benign Het
Atp6ap1l A G 13: 90,886,723 F180S probably benign Het
Cfd G A 10: 79,891,719 V77M probably damaging Het
Col5a2 A T 1: 45,383,604 L1151H probably damaging Het
Dennd3 G A 15: 73,556,366 V854M possibly damaging Het
Dlg5 C T 14: 24,190,373 R247Q probably damaging Het
Fam3c G C 6: 22,328,670 P53A probably benign Het
Gpbp1 T C 13: 111,438,085 N302D possibly damaging Het
Hmcn1 A G 1: 150,745,033 V1142A probably benign Het
Ighv9-3 G A 12: 114,140,924 S40F probably damaging Het
Insr C T 8: 3,198,111 R478H probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Larp1 A G 11: 58,057,330 D985G probably damaging Het
Loxl3 A T 6: 83,050,664 H729L probably damaging Het
Lrrc14b T C 13: 74,360,762 M509V probably benign Het
Lrrc8e A G 8: 4,234,798 Y341C probably damaging Het
Mettl18 A G 1: 163,996,800 D230G possibly damaging Het
Mup12 T C 4: 60,741,309 probably benign Het
Myo1c T C 11: 75,672,201 S1020P probably benign Het
Olfr399 C A 11: 74,054,384 R125L probably damaging Het
Phkb T C 8: 86,029,546 I823T probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rpap2 T C 5: 107,603,630 probably null Het
Rpl38 T C 11: 114,668,768 probably benign Het
Scn8a T C 15: 100,974,627 F516L probably benign Het
Slco1a6 T C 6: 142,099,350 E470G possibly damaging Het
Spag17 C A 3: 100,092,950 H1811N probably benign Het
Sycp2 C T 2: 178,354,960 C1150Y probably damaging Het
Ttc12 A G 9: 49,438,418 V693A probably benign Het
Wdr83 C T 8: 85,080,149 V101I probably benign Het
Wnt3 G T 11: 103,812,585 R298L probably damaging Het
Other mutations in Slc51a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03160:Slc51a APN 16 32478750 missense probably damaging 1.00
IGL03201:Slc51a APN 16 32478750 missense probably damaging 1.00
IGL03227:Slc51a APN 16 32478750 missense probably damaging 1.00
IGL03228:Slc51a APN 16 32478750 missense probably damaging 1.00
IGL03267:Slc51a APN 16 32478750 missense probably damaging 1.00
R0109:Slc51a UTSW 16 32477607 missense probably benign 0.02
R0419:Slc51a UTSW 16 32476436 missense possibly damaging 0.90
R0744:Slc51a UTSW 16 32475849 missense probably benign 0.03
R0836:Slc51a UTSW 16 32475849 missense probably benign 0.03
R3751:Slc51a UTSW 16 32476474 missense probably benign 0.43
R5089:Slc51a UTSW 16 32477546 critical splice donor site probably null
R5424:Slc51a UTSW 16 32478747 missense probably benign 0.11
R5924:Slc51a UTSW 16 32477172 missense possibly damaging 0.80
R6020:Slc51a UTSW 16 32479766 missense probably damaging 1.00
R6592:Slc51a UTSW 16 32475803 missense probably damaging 1.00
R7267:Slc51a UTSW 16 32479772 missense probably benign 0.00
R7876:Slc51a UTSW 16 32478783 missense probably benign 0.11
R8323:Slc51a UTSW 16 32476379 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTAGCCTTGCAAACAGGTG -3'
(R):5'- CATCCTCGGACTTTATTTGGTG -3'

Sequencing Primer
(F):5'- TGGGGATCAGTTCACATCAC -3'
(R):5'- GTTTAACAACTTGTAGGCATTCCTGG -3'
Posted On2018-07-23