Incidental Mutation 'R6707:Arhgef28'
ID528994
Institutional Source Beutler Lab
Gene Symbol Arhgef28
Ensembl Gene ENSMUSG00000021662
Gene NameRho guanine nucleotide exchange factor (GEF) 28
SynonymsRhoGEF, Rgnef, Rho specific exchange factor, p190RhoGEF, 9230110L08Rik, D13Bwg1089e, RIP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6707 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location97899469-98206439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98075116 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 120 (T120A)
Ref Sequence ENSEMBL: ENSMUSP00000153000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109426] [ENSMUST00000223849] [ENSMUST00000225884]
Predicted Effect probably benign
Transcript: ENSMUST00000109426
AA Change: T120A

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105053
Gene: ENSMUSG00000021662
AA Change: T120A

DomainStartEndE-ValueType
low complexity region 530 568 N/A INTRINSIC
low complexity region 634 650 N/A INTRINSIC
C1 652 698 1.65e-11 SMART
RhoGEF 850 1040 1.11e-65 SMART
PH 1084 1187 1.08e-9 SMART
low complexity region 1267 1281 N/A INTRINSIC
coiled coil region 1469 1522 N/A INTRINSIC
low complexity region 1647 1663 N/A INTRINSIC
low complexity region 1682 1693 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000223849
AA Change: T120A

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225884
AA Change: T120A

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.1141 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho guanine nucleotide exchange factor family. The encoded protein interacts with low molecular weight neurofilament mRNA and may be involved in the formation of amyotrophic lateral sclerosis neurofilament aggregates. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are born at lower than expected Mendelian ratios and exhibit a reduction in overall size that becomes negligible by 8 weeks of age. Mouse embryonic fibroblasts display defects in cell migration and focal adhesion formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,223,122 V1943M probably benign Het
Acss3 T C 10: 107,084,922 Y109C probably damaging Het
Actg2 C T 6: 83,513,094 W341* probably null Het
Adam29 C T 8: 55,872,100 G440R probably damaging Het
AI314180 T A 4: 58,879,101 I63L possibly damaging Het
Arfgef3 T C 10: 18,621,155 D1153G probably benign Het
BC051665 A T 13: 60,784,408 D122E probably benign Het
Boc A T 16: 44,500,616 I227N possibly damaging Het
Clca3b T A 3: 144,844,527 Q219L probably benign Het
Cyp2c66 T A 19: 39,186,500 F448Y probably damaging Het
Ddx5 A G 11: 106,782,232 M489T probably benign Het
Dnm1 T C 2: 32,336,241 D312G probably null Het
Eqtn T C 4: 94,907,819 D215G probably benign Het
Evi5l A T 8: 4,206,322 T706S probably benign Het
Gtf2f1 T C 17: 57,007,770 E90G probably benign Het
Hpx A T 7: 105,595,475 S168T probably benign Het
Ipo4 C A 14: 55,628,904 V773L possibly damaging Het
Ireb2 C T 9: 54,903,961 T716I probably damaging Het
Klhl21 A G 4: 152,012,327 D350G possibly damaging Het
Myh13 A T 11: 67,350,260 N821I probably damaging Het
Nipbl G T 15: 8,324,559 T1698K probably benign Het
Nod2 A G 8: 88,665,189 H686R probably benign Het
Ntf3 A G 6: 126,164,728 probably null Het
Olfr811 G T 10: 129,801,820 A235D probably damaging Het
Olfr816 T C 10: 129,911,739 T180A probably benign Het
Parp9 A T 16: 35,947,933 H161L probably damaging Het
Pkhd1l1 A G 15: 44,529,143 N1625D probably benign Het
Rdx T C 9: 52,063,654 F30S probably damaging Het
Smo T A 6: 29,736,174 V55E probably benign Het
Sox9 C A 11: 112,782,872 N96K probably damaging Het
Spp2 T G 1: 88,417,294 probably null Het
Tex46 A G 4: 136,612,850 N82S probably benign Het
Timm22 C T 11: 76,407,325 L41F possibly damaging Het
Tmem30a A T 9: 79,774,265 Y207* probably null Het
Tmem70 T C 1: 16,677,307 V216A probably damaging Het
Tspan18 T C 2: 93,209,957 N151S probably benign Het
Vmn2r90 T C 17: 17,728,102 C537R probably damaging Het
Vps50 A G 6: 3,545,583 Y339C probably damaging Het
Zp2 C T 7: 120,133,922 G599R possibly damaging Het
Other mutations in Arhgef28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Arhgef28 APN 13 97988277 missense probably benign 0.15
IGL00945:Arhgef28 APN 13 97967399 missense possibly damaging 0.88
IGL01099:Arhgef28 APN 13 97953972 splice site probably benign
IGL01328:Arhgef28 APN 13 97970323 missense probably damaging 1.00
IGL01396:Arhgef28 APN 13 97953893 missense probably damaging 0.99
IGL02067:Arhgef28 APN 13 98077317 missense probably damaging 1.00
IGL02147:Arhgef28 APN 13 97961314 missense probably damaging 1.00
IGL02285:Arhgef28 APN 13 98051028 missense possibly damaging 0.85
IGL02439:Arhgef28 APN 13 97931139 missense possibly damaging 0.75
IGL02499:Arhgef28 APN 13 97953783 missense possibly damaging 0.87
IGL02532:Arhgef28 APN 13 98029883 missense probably damaging 0.99
IGL02634:Arhgef28 APN 13 98051058 missense probably benign 0.00
IGL02902:Arhgef28 APN 13 97946875 missense probably damaging 1.00
IGL03067:Arhgef28 APN 13 97988286 missense probably benign 0.00
IGL03081:Arhgef28 APN 13 98029373 splice site probably benign
IGL03106:Arhgef28 APN 13 97957793 missense probably damaging 1.00
IGL03195:Arhgef28 APN 13 97951563 splice site probably null
IGL03325:Arhgef28 APN 13 97899816 missense probably benign 0.03
H8786:Arhgef28 UTSW 13 97946953 missense probably damaging 1.00
R0027:Arhgef28 UTSW 13 97945696 missense possibly damaging 0.94
R0027:Arhgef28 UTSW 13 97945696 missense possibly damaging 0.94
R0062:Arhgef28 UTSW 13 97956642 missense possibly damaging 0.56
R0062:Arhgef28 UTSW 13 97956642 missense possibly damaging 0.56
R0090:Arhgef28 UTSW 13 98075110 missense probably damaging 0.99
R0096:Arhgef28 UTSW 13 97931254 missense probably damaging 1.00
R0096:Arhgef28 UTSW 13 97931254 missense probably damaging 1.00
R0537:Arhgef28 UTSW 13 97957716 missense probably damaging 1.00
R0617:Arhgef28 UTSW 13 97970355 missense probably benign 0.21
R0711:Arhgef28 UTSW 13 97931254 missense probably damaging 1.00
R0723:Arhgef28 UTSW 13 97939479 missense probably benign 0.16
R0790:Arhgef28 UTSW 13 97981406 missense possibly damaging 0.51
R1240:Arhgef28 UTSW 13 97929492 missense probably benign 0.00
R1365:Arhgef28 UTSW 13 98075124 missense probably damaging 1.00
R1456:Arhgef28 UTSW 13 98075002 missense probably benign 0.01
R1490:Arhgef28 UTSW 13 97978444 missense probably damaging 1.00
R1496:Arhgef28 UTSW 13 97965546 missense possibly damaging 0.93
R1660:Arhgef28 UTSW 13 97981376 missense probably benign 0.05
R1671:Arhgef28 UTSW 13 97931034 missense possibly damaging 0.95
R1747:Arhgef28 UTSW 13 97936824 missense probably damaging 1.00
R1792:Arhgef28 UTSW 13 97931186 missense probably benign 0.03
R1864:Arhgef28 UTSW 13 97994132 missense probably benign 0.00
R1887:Arhgef28 UTSW 13 98145573 missense probably damaging 0.97
R1924:Arhgef28 UTSW 13 97936816 splice site probably benign
R1987:Arhgef28 UTSW 13 97967096 missense probably benign
R2215:Arhgef28 UTSW 13 98051021 missense possibly damaging 0.78
R2342:Arhgef28 UTSW 13 97994029 missense probably benign 0.00
R2495:Arhgef28 UTSW 13 98029373 splice site probably benign
R3897:Arhgef28 UTSW 13 97956576 missense probably damaging 1.00
R3922:Arhgef28 UTSW 13 97993944 missense possibly damaging 0.92
R4063:Arhgef28 UTSW 13 97994067 missense probably benign 0.16
R4086:Arhgef28 UTSW 13 97967204 missense probably damaging 0.98
R4543:Arhgef28 UTSW 13 98075000 missense probably benign 0.00
R4730:Arhgef28 UTSW 13 97978142 missense probably benign 0.00
R4735:Arhgef28 UTSW 13 97899729 missense probably damaging 1.00
R4953:Arhgef28 UTSW 13 97929554 missense possibly damaging 0.51
R5069:Arhgef28 UTSW 13 98075206 missense probably damaging 0.96
R5558:Arhgef28 UTSW 13 97961460 missense probably damaging 1.00
R5573:Arhgef28 UTSW 13 97929491 missense probably benign 0.01
R5594:Arhgef28 UTSW 13 97939492 missense probably benign 0.00
R5937:Arhgef28 UTSW 13 97939543 missense probably benign 0.00
R5987:Arhgef28 UTSW 13 97936860 nonsense probably null
R6015:Arhgef28 UTSW 13 98075022 missense possibly damaging 0.73
R6193:Arhgef28 UTSW 13 97985380 missense probably damaging 1.00
R6209:Arhgef28 UTSW 13 97929409 critical splice donor site probably null
R6306:Arhgef28 UTSW 13 97985388 missense probably damaging 1.00
R6393:Arhgef28 UTSW 13 97994019 missense possibly damaging 0.64
R6562:Arhgef28 UTSW 13 97988139 critical splice donor site probably null
R6646:Arhgef28 UTSW 13 97939494 missense probably benign 0.09
R6655:Arhgef28 UTSW 13 97899655 missense probably damaging 1.00
R6707:Arhgef28 UTSW 13 97936716 missense probably damaging 0.96
R6751:Arhgef28 UTSW 13 98075247 missense probably damaging 0.97
R6940:Arhgef28 UTSW 13 97965530 missense possibly damaging 0.58
R7018:Arhgef28 UTSW 13 97965435 missense probably damaging 1.00
R7030:Arhgef28 UTSW 13 97988261 missense possibly damaging 0.88
R7120:Arhgef28 UTSW 13 97944539 missense probably damaging 1.00
R7266:Arhgef28 UTSW 13 97965452 missense probably benign
R7353:Arhgef28 UTSW 13 98075202 missense probably damaging 1.00
R7368:Arhgef28 UTSW 13 97996862 missense probably benign 0.34
R7491:Arhgef28 UTSW 13 97944686 missense probably benign 0.03
R7500:Arhgef28 UTSW 13 97978495 missense probably benign 0.00
R7653:Arhgef28 UTSW 13 97969313 missense probably benign 0.04
R7813:Arhgef28 UTSW 13 97945681 missense possibly damaging 0.48
Z1088:Arhgef28 UTSW 13 97945691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTACCCAGAGAAACGGAG -3'
(R):5'- CCTGCAGATATGGACTGAGTGG -3'

Sequencing Primer
(F):5'- TCTACCCAGAGAAACGGAGAGTAAAC -3'
(R):5'- ATCTTGTCATTTAGGCCACTGG -3'
Posted On2018-07-24