Mutagenetix > Incidental Mutations

Incidental Mutation 'R6707:Arhgef28'

528994

Institutional Source

Beutler Lab

Gene Symbol

Arhgef28

Ensembl Gene

ENSMUSG00000021662

Gene Name

Rho guanine nucleotide exchange factor (GEF) 28

Synonyms

RhoGEF, Rgnef, Rho specific exchange factor, p190RhoGEF, 9230110L08Rik, D13Bwg1089e, RIP2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6707 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

97899469-98206439 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 98075116 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 120 (T120A)

Ref Sequence

ENSEMBL: ENSMUSP00000153000 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109426] [ENSMUST00000223849] [ENSMUST00000225884]

Predicted Effect

probably benign
Transcript: ENSMUST00000109426
AA Change: T120A

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000105053
Gene: ENSMUSG00000021662
AA Change: T120A

Domain	Start	End	E-Value	Type
low complexity region	530	568	N/A	INTRINSIC
low complexity region	634	650	N/A	INTRINSIC
C1	652	698	1.65e-11	SMART
RhoGEF	850	1040	1.11e-65	SMART
PH	1084	1187	1.08e-9	SMART
low complexity region	1267	1281	N/A	INTRINSIC
coiled coil region	1469	1522	N/A	INTRINSIC
low complexity region	1647	1663	N/A	INTRINSIC
low complexity region	1682	1693	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223849
AA Change: T120A

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225884
AA Change: T120A

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)

Meta Mutation Damage Score

0.1141

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho guanine nucleotide exchange factor family. The encoded protein interacts with low molecular weight neurofilament mRNA and may be involved in the formation of amyotrophic lateral sclerosis neurofilament aggregates. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are born at lower than expected Mendelian ratios and exhibit a reduction in overall size that becomes negligible by 8 weeks of age. Mouse embryonic fibroblasts display defects in cell migration and focal adhesion formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	G	A	15: 8,223,122	V1943M	probably benign	Het
Acss3	T	C	10: 107,084,922	Y109C	probably damaging	Het
Actg2	C	T	6: 83,513,094	W341*	probably null	Het
Adam29	C	T	8: 55,872,100	G440R	probably damaging	Het
AI314180	T	A	4: 58,879,101	I63L	possibly damaging	Het
Arfgef3	T	C	10: 18,621,155	D1153G	probably benign	Het
BC051665	A	T	13: 60,784,408	D122E	probably benign	Het
Boc	A	T	16: 44,500,616	I227N	possibly damaging	Het
Clca3b	T	A	3: 144,844,527	Q219L	probably benign	Het
Cyp2c66	T	A	19: 39,186,500	F448Y	probably damaging	Het
Ddx5	A	G	11: 106,782,232	M489T	probably benign	Het
Dnm1	T	C	2: 32,336,241	D312G	probably null	Het
Eqtn	T	C	4: 94,907,819	D215G	probably benign	Het
Evi5l	A	T	8: 4,206,322	T706S	probably benign	Het
Gtf2f1	T	C	17: 57,007,770	E90G	probably benign	Het
Hpx	A	T	7: 105,595,475	S168T	probably benign	Het
Ipo4	C	A	14: 55,628,904	V773L	possibly damaging	Het
Ireb2	C	T	9: 54,903,961	T716I	probably damaging	Het
Klhl21	A	G	4: 152,012,327	D350G	possibly damaging	Het
Myh13	A	T	11: 67,350,260	N821I	probably damaging	Het
Nipbl	G	T	15: 8,324,559	T1698K	probably benign	Het
Nod2	A	G	8: 88,665,189	H686R	probably benign	Het
Ntf3	A	G	6: 126,164,728		probably null	Het
Olfr811	G	T	10: 129,801,820	A235D	probably damaging	Het
Olfr816	T	C	10: 129,911,739	T180A	probably benign	Het
Parp9	A	T	16: 35,947,933	H161L	probably damaging	Het
Pkhd1l1	A	G	15: 44,529,143	N1625D	probably benign	Het
Rdx	T	C	9: 52,063,654	F30S	probably damaging	Het
Smo	T	A	6: 29,736,174	V55E	probably benign	Het
Sox9	C	A	11: 112,782,872	N96K	probably damaging	Het
Spp2	T	G	1: 88,417,294		probably null	Het
Tex46	A	G	4: 136,612,850	N82S	probably benign	Het
Timm22	C	T	11: 76,407,325	L41F	possibly damaging	Het
Tmem30a	A	T	9: 79,774,265	Y207*	probably null	Het
Tmem70	T	C	1: 16,677,307	V216A	probably damaging	Het
Tspan18	T	C	2: 93,209,957	N151S	probably benign	Het
Vmn2r90	T	C	17: 17,728,102	C537R	probably damaging	Het
Vps50	A	G	6: 3,545,583	Y339C	probably damaging	Het
Zp2	C	T	7: 120,133,922	G599R	possibly damaging	Het

Other mutations in Arhgef28

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:Arhgef28	APN	13	97988277	missense	probably benign	0.15
IGL00945:Arhgef28	APN	13	97967399	missense	possibly damaging	0.88
IGL01099:Arhgef28	APN	13	97953972	splice site	probably benign
IGL01328:Arhgef28	APN	13	97970323	missense	probably damaging	1.00
IGL01396:Arhgef28	APN	13	97953893	missense	probably damaging	0.99
IGL02067:Arhgef28	APN	13	98077317	missense	probably damaging	1.00
IGL02147:Arhgef28	APN	13	97961314	missense	probably damaging	1.00
IGL02285:Arhgef28	APN	13	98051028	missense	possibly damaging	0.85
IGL02439:Arhgef28	APN	13	97931139	missense	possibly damaging	0.75
IGL02499:Arhgef28	APN	13	97953783	missense	possibly damaging	0.87
IGL02532:Arhgef28	APN	13	98029883	missense	probably damaging	0.99
IGL02634:Arhgef28	APN	13	98051058	missense	probably benign	0.00
IGL02902:Arhgef28	APN	13	97946875	missense	probably damaging	1.00
IGL03067:Arhgef28	APN	13	97988286	missense	probably benign	0.00
IGL03081:Arhgef28	APN	13	98029373	splice site	probably benign
IGL03106:Arhgef28	APN	13	97957793	missense	probably damaging	1.00
IGL03195:Arhgef28	APN	13	97951563	splice site	probably null
IGL03325:Arhgef28	APN	13	97899816	missense	probably benign	0.03
H8786:Arhgef28	UTSW	13	97946953	missense	probably damaging	1.00
R0027:Arhgef28	UTSW	13	97945696	missense	possibly damaging	0.94
R0027:Arhgef28	UTSW	13	97945696	missense	possibly damaging	0.94
R0062:Arhgef28	UTSW	13	97956642	missense	possibly damaging	0.56
R0062:Arhgef28	UTSW	13	97956642	missense	possibly damaging	0.56
R0090:Arhgef28	UTSW	13	98075110	missense	probably damaging	0.99
R0096:Arhgef28	UTSW	13	97931254	missense	probably damaging	1.00
R0096:Arhgef28	UTSW	13	97931254	missense	probably damaging	1.00
R0537:Arhgef28	UTSW	13	97957716	missense	probably damaging	1.00
R0617:Arhgef28	UTSW	13	97970355	missense	probably benign	0.21
R0711:Arhgef28	UTSW	13	97931254	missense	probably damaging	1.00
R0723:Arhgef28	UTSW	13	97939479	missense	probably benign	0.16
R0790:Arhgef28	UTSW	13	97981406	missense	possibly damaging	0.51
R1240:Arhgef28	UTSW	13	97929492	missense	probably benign	0.00
R1365:Arhgef28	UTSW	13	98075124	missense	probably damaging	1.00
R1456:Arhgef28	UTSW	13	98075002	missense	probably benign	0.01
R1490:Arhgef28	UTSW	13	97978444	missense	probably damaging	1.00
R1496:Arhgef28	UTSW	13	97965546	missense	possibly damaging	0.93
R1660:Arhgef28	UTSW	13	97981376	missense	probably benign	0.05
R1671:Arhgef28	UTSW	13	97931034	missense	possibly damaging	0.95
R1747:Arhgef28	UTSW	13	97936824	missense	probably damaging	1.00
R1792:Arhgef28	UTSW	13	97931186	missense	probably benign	0.03
R1864:Arhgef28	UTSW	13	97994132	missense	probably benign	0.00
R1887:Arhgef28	UTSW	13	98145573	missense	probably damaging	0.97
R1924:Arhgef28	UTSW	13	97936816	splice site	probably benign
R1987:Arhgef28	UTSW	13	97967096	missense	probably benign
R2215:Arhgef28	UTSW	13	98051021	missense	possibly damaging	0.78
R2342:Arhgef28	UTSW	13	97994029	missense	probably benign	0.00
R2495:Arhgef28	UTSW	13	98029373	splice site	probably benign
R3897:Arhgef28	UTSW	13	97956576	missense	probably damaging	1.00
R3922:Arhgef28	UTSW	13	97993944	missense	possibly damaging	0.92
R4063:Arhgef28	UTSW	13	97994067	missense	probably benign	0.16
R4086:Arhgef28	UTSW	13	97967204	missense	probably damaging	0.98
R4543:Arhgef28	UTSW	13	98075000	missense	probably benign	0.00
R4730:Arhgef28	UTSW	13	97978142	missense	probably benign	0.00
R4735:Arhgef28	UTSW	13	97899729	missense	probably damaging	1.00
R4953:Arhgef28	UTSW	13	97929554	missense	possibly damaging	0.51
R5069:Arhgef28	UTSW	13	98075206	missense	probably damaging	0.96
R5558:Arhgef28	UTSW	13	97961460	missense	probably damaging	1.00
R5573:Arhgef28	UTSW	13	97929491	missense	probably benign	0.01
R5594:Arhgef28	UTSW	13	97939492	missense	probably benign	0.00
R5937:Arhgef28	UTSW	13	97939543	missense	probably benign	0.00
R5987:Arhgef28	UTSW	13	97936860	nonsense	probably null
R6015:Arhgef28	UTSW	13	98075022	missense	possibly damaging	0.73
R6193:Arhgef28	UTSW	13	97985380	missense	probably damaging	1.00
R6209:Arhgef28	UTSW	13	97929409	critical splice donor site	probably null
R6306:Arhgef28	UTSW	13	97985388	missense	probably damaging	1.00
R6393:Arhgef28	UTSW	13	97994019	missense	possibly damaging	0.64
R6562:Arhgef28	UTSW	13	97988139	critical splice donor site	probably null
R6646:Arhgef28	UTSW	13	97939494	missense	probably benign	0.09
R6655:Arhgef28	UTSW	13	97899655	missense	probably damaging	1.00
R6707:Arhgef28	UTSW	13	97936716	missense	probably damaging	0.96
R6751:Arhgef28	UTSW	13	98075247	missense	probably damaging	0.97
R6940:Arhgef28	UTSW	13	97965530	missense	possibly damaging	0.58
R7018:Arhgef28	UTSW	13	97965435	missense	probably damaging	1.00
R7030:Arhgef28	UTSW	13	97988261	missense	possibly damaging	0.88
R7120:Arhgef28	UTSW	13	97944539	missense	probably damaging	1.00
R7266:Arhgef28	UTSW	13	97965452	missense	probably benign
R7353:Arhgef28	UTSW	13	98075202	missense	probably damaging	1.00
R7368:Arhgef28	UTSW	13	97996862	missense	probably benign	0.34
R7491:Arhgef28	UTSW	13	97944686	missense	probably benign	0.03
R7500:Arhgef28	UTSW	13	97978495	missense	probably benign	0.00
R7653:Arhgef28	UTSW	13	97969313	missense	probably benign	0.04
R7813:Arhgef28	UTSW	13	97945681	missense	possibly damaging	0.48
Z1088:Arhgef28	UTSW	13	97945691	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCTACCCAGAGAAACGGAG -3'
(R):5'- CCTGCAGATATGGACTGAGTGG -3'

Sequencing Primer
(F):5'- TCTACCCAGAGAAACGGAGAGTAAAC -3'
(R):5'- ATCTTGTCATTTAGGCCACTGG -3'

Posted On

2018-07-24