Mutagenetix > Incidental Mutation

Incidental Mutation 'R7353:Arhgef28'

570761

Institutional Source

Beutler Lab

Gene Symbol

Arhgef28

Ensembl Gene

ENSMUSG00000021662

Gene Name

Rho guanine nucleotide exchange factor (GEF) 28

Synonyms

RhoGEF, Rgnef, Rho specific exchange factor, p190RhoGEF, 9230110L08Rik, D13Bwg1089e, RIP2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7353 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

97899469-98206439 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 98075202 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 91 (Y91F)

Ref Sequence

ENSEMBL: ENSMUSP00000105053 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109426] [ENSMUST00000223849] [ENSMUST00000225884]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000109426
AA Change: Y91F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105053
Gene: ENSMUSG00000021662
AA Change: Y91F

Domain	Start	End	E-Value	Type
low complexity region	530	568	N/A	INTRINSIC
low complexity region	634	650	N/A	INTRINSIC
C1	652	698	1.65e-11	SMART
RhoGEF	850	1040	1.11e-65	SMART
PH	1084	1187	1.08e-9	SMART
low complexity region	1267	1281	N/A	INTRINSIC
coiled coil region	1469	1522	N/A	INTRINSIC
low complexity region	1647	1663	N/A	INTRINSIC
low complexity region	1682	1693	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000223849
AA Change: Y91F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225884
AA Change: Y91F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho guanine nucleotide exchange factor family. The encoded protein interacts with low molecular weight neurofilament mRNA and may be involved in the formation of amyotrophic lateral sclerosis neurofilament aggregates. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are born at lower than expected Mendelian ratios and exhibit a reduction in overall size that becomes negligible by 8 weeks of age. Mouse embryonic fibroblasts display defects in cell migration and focal adhesion formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110070M22Rik	C	A	13: 119,488,178	A11S	unknown	Het
Aadacl4	G	A	4: 144,617,920	V89I	probably damaging	Het
Abcc9	T	A	6: 142,601,005	I1369F	probably damaging	Het
Adgrf3	T	A	5: 30,198,497	I427F	probably damaging	Het
Alox12e	T	C	11: 70,321,435	Y139C	probably damaging	Het
Arhgef2	T	A	3: 88,635,686	V397E	possibly damaging	Het
Bcar3	A	G	3: 122,512,692	T454A	probably benign	Het
Bicc1	G	T	10: 70,947,900	T469K	probably benign	Het
Boc	C	T	16: 44,485,737	V1070M	unknown	Het
Ccdc88a	T	A	11: 29,463,368	N635K	probably benign	Het
Ccr2	T	C	9: 124,106,756	S358P	probably damaging	Het
Ccser2	T	C	14: 36,941,143	Q28R	possibly damaging	Het
Cenpf	T	A	1: 189,654,138	K1982*	probably null	Het
Csn1s2a	A	T	5: 87,785,302	I137F	possibly damaging	Het
Cttnbp2	A	T	6: 18,375,944	I1532K	possibly damaging	Het
Dnajc13	C	A	9: 104,230,031	R304L	possibly damaging	Het
Dopey1	T	A	9: 86,512,859	M664K	probably damaging	Het
Emilin3	T	A	2: 160,908,821	E336V	probably damaging	Het
Eml5	A	G	12: 98,825,424	Y63H		Het
Fbxo41	G	T	6: 85,479,976	R404S	possibly damaging	Het
Gm8897	G	A	5: 11,416,436	D7N	possibly damaging	Het
Gpr155	A	T	2: 73,367,491	Y456*	probably null	Het
Gpr156	T	A	16: 37,992,161	N286K	probably damaging	Het
Kcna5	A	G	6: 126,534,845	S107P	probably benign	Het
Kcne2	A	T	16: 92,296,822	H79L	possibly damaging	Het
Kcnh4	T	A	11: 100,757,199	M113L	probably benign	Het
Lad1	T	A	1: 135,827,775	L263Q	probably damaging	Het
Lctl	G	A	9: 64,126,967	G296D	probably damaging	Het
Lmtk3	A	T	7: 45,788,000	I205F	possibly damaging	Het
Magel2	G	T	7: 62,379,331	R661L	unknown	Het
Mcm10	G	A	2: 5,007,109	P180S	possibly damaging	Het
Mia3	G	T	1: 183,327,392	A446D		Het
N4bp2	G	A	5: 65,806,371	V588M	probably benign	Het
Naip6	C	T	13: 100,299,751	V755M	probably benign	Het
Neurl1a	T	C	19: 47,240,660	V213A	probably damaging	Het
Nrd1	A	G	4: 109,039,749	T522A	probably damaging	Het
Ntng1	T	C	3: 110,135,447	Q21R	probably damaging	Het
Nup160	T	C	2: 90,703,952	L707S	probably damaging	Het
Oas2	A	T	5: 120,738,522	V452D	probably damaging	Het
Olfr3	A	G	2: 36,812,903	L63P	probably damaging	Het
Olfr350	A	T	2: 36,850,069	M8L	probably benign	Het
Olfr351	G	A	2: 36,859,668	R227*	probably null	Het
Olfr519	A	G	7: 108,894,222	F67L	probably damaging	Het
Olfr593	A	C	7: 103,212,309	T150P	probably damaging	Het
Plekhg1	A	T	10: 3,964,327	T1405S		Het
Pnrc1	G	A	4: 33,248,300	P33L	probably damaging	Het
Prkag2	A	T	5: 24,880,686	V312E	possibly damaging	Het
Rps17	T	A	7: 81,344,345	E76V	possibly damaging	Het
Rsph10b	G	A	5: 143,967,220	G672S	possibly damaging	Het
Slc2a13	T	C	15: 91,321,604	N460S	probably benign	Het
Slco2b1	A	T	7: 99,690,557	C56S	possibly damaging	Het
Spn	T	C	7: 127,137,006	T110A	probably benign	Het
Sult2a8	T	C	7: 14,413,715	N217S	possibly damaging	Het
Tbx2	C	A	11: 85,833,489	T128N	probably damaging	Het
Tecpr2	A	T	12: 110,967,844	M1313L	probably benign	Het
Tmc2	G	A	2: 130,196,577		probably null	Het
Tstd1	G	T	1: 171,419,955	A69S	probably damaging	Het
Txnrd3	A	G	6: 89,661,585	D252G	probably benign	Het
Ulk2	T	C	11: 61,819,348	N345D	probably damaging	Het
Unc13c	T	C	9: 73,574,073	D1694G	probably benign	Het
Vill	T	C	9: 119,065,493	V406A	probably damaging	Het
Vmn2r115	T	C	17: 23,345,913	V258A	possibly damaging	Het
Vmn2r82	T	A	10: 79,396,618	M817K	probably benign	Het
Xpnpep3	T	C	15: 81,430,887	S263P	probably benign	Het
Zfp980	A	G	4: 145,702,144	D481G	probably benign	Het
Zmpste24	A	G	4: 121,095,581	S81P	probably damaging	Het
Znrf4	A	G	17: 56,512,169	V46A	probably benign	Het

Other mutations in Arhgef28

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:Arhgef28	APN	13	97988277	missense	probably benign	0.15
IGL00945:Arhgef28	APN	13	97967399	missense	possibly damaging	0.88
IGL01099:Arhgef28	APN	13	97953972	splice site	probably benign
IGL01328:Arhgef28	APN	13	97970323	missense	probably damaging	1.00
IGL01396:Arhgef28	APN	13	97953893	missense	probably damaging	0.99
IGL02067:Arhgef28	APN	13	98077317	missense	probably damaging	1.00
IGL02147:Arhgef28	APN	13	97961314	missense	probably damaging	1.00
IGL02285:Arhgef28	APN	13	98051028	missense	possibly damaging	0.85
IGL02439:Arhgef28	APN	13	97931139	missense	possibly damaging	0.75
IGL02499:Arhgef28	APN	13	97953783	missense	possibly damaging	0.87
IGL02532:Arhgef28	APN	13	98029883	missense	probably damaging	0.99
IGL02634:Arhgef28	APN	13	98051058	missense	probably benign	0.00
IGL02902:Arhgef28	APN	13	97946875	missense	probably damaging	1.00
IGL03067:Arhgef28	APN	13	97988286	missense	probably benign	0.00
IGL03081:Arhgef28	APN	13	98029373	splice site	probably benign
IGL03106:Arhgef28	APN	13	97957793	missense	probably damaging	1.00
IGL03195:Arhgef28	APN	13	97951563	splice site	probably null
IGL03325:Arhgef28	APN	13	97899816	missense	probably benign	0.03
H8786:Arhgef28	UTSW	13	97946953	missense	probably damaging	1.00
R0027:Arhgef28	UTSW	13	97945696	missense	possibly damaging	0.94
R0027:Arhgef28	UTSW	13	97945696	missense	possibly damaging	0.94
R0062:Arhgef28	UTSW	13	97956642	missense	possibly damaging	0.56
R0062:Arhgef28	UTSW	13	97956642	missense	possibly damaging	0.56
R0090:Arhgef28	UTSW	13	98075110	missense	probably damaging	0.99
R0096:Arhgef28	UTSW	13	97931254	missense	probably damaging	1.00
R0096:Arhgef28	UTSW	13	97931254	missense	probably damaging	1.00
R0537:Arhgef28	UTSW	13	97957716	missense	probably damaging	1.00
R0617:Arhgef28	UTSW	13	97970355	missense	probably benign	0.21
R0711:Arhgef28	UTSW	13	97931254	missense	probably damaging	1.00
R0723:Arhgef28	UTSW	13	97939479	missense	probably benign	0.16
R0790:Arhgef28	UTSW	13	97981406	missense	possibly damaging	0.51
R1240:Arhgef28	UTSW	13	97929492	missense	probably benign	0.00
R1365:Arhgef28	UTSW	13	98075124	missense	probably damaging	1.00
R1456:Arhgef28	UTSW	13	98075002	missense	probably benign	0.01
R1490:Arhgef28	UTSW	13	97978444	missense	probably damaging	1.00
R1496:Arhgef28	UTSW	13	97965546	missense	possibly damaging	0.93
R1660:Arhgef28	UTSW	13	97981376	missense	probably benign	0.05
R1671:Arhgef28	UTSW	13	97931034	missense	possibly damaging	0.95
R1747:Arhgef28	UTSW	13	97936824	missense	probably damaging	1.00
R1792:Arhgef28	UTSW	13	97931186	missense	probably benign	0.03
R1864:Arhgef28	UTSW	13	97994132	missense	probably benign	0.00
R1887:Arhgef28	UTSW	13	98145573	missense	probably damaging	0.97
R1924:Arhgef28	UTSW	13	97936816	splice site	probably benign
R1987:Arhgef28	UTSW	13	97967096	missense	probably benign
R2215:Arhgef28	UTSW	13	98051021	missense	possibly damaging	0.78
R2342:Arhgef28	UTSW	13	97994029	missense	probably benign	0.00
R2495:Arhgef28	UTSW	13	98029373	splice site	probably benign
R3897:Arhgef28	UTSW	13	97956576	missense	probably damaging	1.00
R3922:Arhgef28	UTSW	13	97993944	missense	possibly damaging	0.92
R4063:Arhgef28	UTSW	13	97994067	missense	probably benign	0.16
R4086:Arhgef28	UTSW	13	97967204	missense	probably damaging	0.98
R4543:Arhgef28	UTSW	13	98075000	missense	probably benign	0.00
R4730:Arhgef28	UTSW	13	97978142	missense	probably benign	0.00
R4735:Arhgef28	UTSW	13	97899729	missense	probably damaging	1.00
R4953:Arhgef28	UTSW	13	97929554	missense	possibly damaging	0.51
R5069:Arhgef28	UTSW	13	98075206	missense	probably damaging	0.96
R5558:Arhgef28	UTSW	13	97961460	missense	probably damaging	1.00
R5573:Arhgef28	UTSW	13	97929491	missense	probably benign	0.01
R5594:Arhgef28	UTSW	13	97939492	missense	probably benign	0.00
R5937:Arhgef28	UTSW	13	97939543	missense	probably benign	0.00
R5987:Arhgef28	UTSW	13	97936860	nonsense	probably null
R6015:Arhgef28	UTSW	13	98075022	missense	possibly damaging	0.73
R6193:Arhgef28	UTSW	13	97985380	missense	probably damaging	1.00
R6209:Arhgef28	UTSW	13	97929409	critical splice donor site	probably null
R6306:Arhgef28	UTSW	13	97985388	missense	probably damaging	1.00
R6393:Arhgef28	UTSW	13	97994019	missense	possibly damaging	0.64
R6562:Arhgef28	UTSW	13	97988139	critical splice donor site	probably null
R6646:Arhgef28	UTSW	13	97939494	missense	probably benign	0.09
R6655:Arhgef28	UTSW	13	97899655	missense	probably damaging	1.00
R6707:Arhgef28	UTSW	13	97936716	missense	probably damaging	0.96
R6707:Arhgef28	UTSW	13	98075116	missense	possibly damaging	0.80
R6751:Arhgef28	UTSW	13	98075247	missense	probably damaging	0.97
R6940:Arhgef28	UTSW	13	97965530	missense	possibly damaging	0.58
R7018:Arhgef28	UTSW	13	97965435	missense	probably damaging	1.00
R7030:Arhgef28	UTSW	13	97988261	missense	possibly damaging	0.88
R7120:Arhgef28	UTSW	13	97944539	missense	probably damaging	1.00
R7266:Arhgef28	UTSW	13	97965452	missense	probably benign
R7368:Arhgef28	UTSW	13	97996862	missense	probably benign	0.34
R7491:Arhgef28	UTSW	13	97944686	missense	probably benign	0.03
R7500:Arhgef28	UTSW	13	97978495	missense	probably benign	0.00
R7653:Arhgef28	UTSW	13	97969313	missense	probably benign	0.04
R7813:Arhgef28	UTSW	13	97945681	missense	possibly damaging	0.48
R7989:Arhgef28	UTSW	13	97899735	missense	probably benign
R8064:Arhgef28	UTSW	13	97978494	missense	probably benign	0.13
R8221:Arhgef28	UTSW	13	98145556	missense	probably benign	0.00
R8293:Arhgef28	UTSW	13	97942521	missense	probably benign	0.00
R8328:Arhgef28	UTSW	13	98051009	missense	possibly damaging	0.88
R8348:Arhgef28	UTSW	13	98053867	missense	possibly damaging	0.50
R8432:Arhgef28	UTSW	13	97951583	missense	probably benign	0.29
R8843:Arhgef28	UTSW	13	97994049	missense	probably benign
R8859:Arhgef28	UTSW	13	97945702	missense	probably damaging	1.00
R8954:Arhgef28	UTSW	13	97929633	missense	probably benign	0.03
R8987:Arhgef28	UTSW	13	98053964	missense	possibly damaging	0.87
R9253:Arhgef28	UTSW	13	97988271	missense	probably benign	0.09
R9351:Arhgef28	UTSW	13	97994068	missense	probably benign	0.11
R9381:Arhgef28	UTSW	13	97899761	missense	possibly damaging	0.60
R9395:Arhgef28	UTSW	13	97967184	frame shift	probably null
R9466:Arhgef28	UTSW	13	97988317	missense
R9529:Arhgef28	UTSW	13	98077265	missense	probably damaging	1.00
R9641:Arhgef28	UTSW	13	97942475	missense	probably benign	0.00
R9662:Arhgef28	UTSW	13	97929461	missense	probably benign	0.20
R9744:Arhgef28	UTSW	13	97957753	missense	probably damaging	1.00
R9776:Arhgef28	UTSW	13	97996907	missense	probably benign	0.19
Z1088:Arhgef28	UTSW	13	97945691	missense	probably damaging	1.00
Z1177:Arhgef28	UTSW	13	97899756	missense	probably benign	0.43

Predicted Primers

PCR Primer
(F):5'- CTGACCTACCTTCAAGTGAGG -3'
(R):5'- AAAGATGGTGCTTGTTCCCTGG -3'

Sequencing Primer
(F):5'- CCTTCAAGTGAGGAATTTCCCAGG -3'
(R):5'- TTCCCTGGAGAGTGCTGC -3'

Posted On

2019-09-13