Incidental Mutation 'R6735:Foxn2'
ID530207
Institutional Source Beutler Lab
Gene Symbol Foxn2
Ensembl Gene ENSMUSG00000034998
Gene Nameforkhead box N2
Synonyms6030465J18Rik, 3230402J05Rik, Fkh19, HTLF
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R6735 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location88440711-88490533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 88486795 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 387 (S387A)
Ref Sequence ENSEMBL: ENSMUSP00000107857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112238] [ENSMUST00000141052]
Predicted Effect probably benign
Transcript: ENSMUST00000112238
AA Change: S387A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107857
Gene: ENSMUSG00000034998
AA Change: S387A

DomainStartEndE-ValueType
FH 110 202 7.42e-50 SMART
low complexity region 314 323 N/A INTRINSIC
low complexity region 348 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141052
SMART Domains Protein: ENSMUSP00000118378
Gene: ENSMUSG00000034998

DomainStartEndE-ValueType
FH 110 203 2.15e-37 SMART
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a forkhead domain binding protein and may function in the transcriptional regulation of the human T-cell leukemia virus long terminal repeat. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,855,900 H230Q probably benign Het
2510039O18Rik A G 4: 147,941,817 T265A probably benign Het
Adap1 A T 5: 139,293,145 Y127N probably damaging Het
Alg8 T C 7: 97,382,982 F246S probably benign Het
Alpk1 A G 3: 127,724,449 Y68H probably damaging Het
Arhgef5 T C 6: 43,275,032 S906P probably benign Het
C9 A T 15: 6,489,906 D408V probably benign Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Cpeb4 T A 11: 31,924,700 Y174N probably benign Het
Enpp3 A G 10: 24,807,453 Y289H probably damaging Het
Erbin A T 13: 103,884,210 D80E probably damaging Het
Fgd6 A T 10: 94,074,320 E829V possibly damaging Het
H2afy2 A G 10: 61,741,267 I274T probably damaging Het
Kif13a A G 13: 46,752,746 S574P possibly damaging Het
Lhx6 T G 2: 36,091,378 D67A probably damaging Het
Lmbr1l A T 15: 98,909,240 M220K probably damaging Het
Lrmp T C 6: 145,160,893 L201S probably damaging Het
Naa35 T C 13: 59,625,564 L111P probably damaging Het
Notch2 T A 3: 98,134,586 V1307E probably damaging Het
Nts T A 10: 102,484,998 M77L probably benign Het
Olfr1029 A C 2: 85,975,434 S64R possibly damaging Het
Pigz A G 16: 31,945,543 N473S probably benign Het
Pkd2 A G 5: 104,480,329 D423G probably damaging Het
Plac8 A G 5: 100,562,619 probably null Het
Ppp2r2b T C 18: 42,688,588 probably null Het
Proc T C 18: 32,123,648 N322S probably benign Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Psd3 A G 8: 68,120,746 probably null Het
Safb A G 17: 56,585,169 probably benign Het
Scnn1g A G 7: 121,742,263 D216G probably benign Het
Sept7 A G 9: 25,303,752 E345G possibly damaging Het
Sult2a5 A T 7: 13,665,058 K197* probably null Het
Suv39h1 C A X: 8,062,899 R397L probably damaging Homo
Thbs4 T A 13: 92,755,166 M814L possibly damaging Het
Tmem14a T A 1: 21,229,581 probably benign Het
Tmprss11d C A 5: 86,309,300 A167S probably damaging Het
Ttn C A 2: 76,798,908 C14362F probably damaging Het
Usp15 T C 10: 123,168,367 I161V possibly damaging Het
Vmn1r67 T C 7: 10,447,211 L134P probably damaging Het
Wdr74 A G 19: 8,736,222 E73G possibly damaging Het
Zbtb49 A T 5: 38,201,058 M617K possibly damaging Het
Zc3h3 G A 15: 75,756,634 T937I probably benign Het
Zeb2 C T 2: 45,110,016 V25M probably null Het
Zfp108 T C 7: 24,261,772 F596S probably damaging Het
Zfyve1 T A 12: 83,594,844 N13Y possibly damaging Het
Zswim2 T C 2: 83,923,761 D185G probably benign Het
Other mutations in Foxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00685:Foxn2 APN 17 88462877 missense probably benign 0.02
IGL00952:Foxn2 APN 17 88475880 missense probably benign 0.03
IGL02232:Foxn2 APN 17 88463051 missense probably benign 0.03
IGL02882:Foxn2 APN 17 88462947 missense probably damaging 1.00
IGL02974:Foxn2 APN 17 88463115 missense probably damaging 1.00
R1170:Foxn2 UTSW 17 88473666 critical splice acceptor site probably benign
R1826:Foxn2 UTSW 17 88486805 missense possibly damaging 0.87
R3825:Foxn2 UTSW 17 88484409 missense probably damaging 0.98
R4761:Foxn2 UTSW 17 88462708 splice site probably null
R5914:Foxn2 UTSW 17 88462710 splice site probably null
R7461:Foxn2 UTSW 17 88486883 missense possibly damaging 0.93
X0026:Foxn2 UTSW 17 88486733 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGATGAGGTGTATGAATTCATCCC -3'
(R):5'- TGGCTCTGACATCCCTGTAAAAG -3'

Sequencing Primer
(F):5'- GGTGTATGAATTCATCCCAAAGAGC -3'
(R):5'- GCTCTGACATCCCTGTAAAAGTTGAG -3'
Posted On2018-08-01