Incidental Mutation 'R6791:Bet1l'
ID532586
Institutional Source Beutler Lab
Gene Symbol Bet1l
Ensembl Gene ENSMUSG00000025484
Gene NameBet1 golgi vesicular membrane trafficking protein like
Synonyms2610021K23Rik, Gs15, golgi SNARE
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R6791 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location140853394-140857577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140854505 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 77 (I77T)
Ref Sequence ENSEMBL: ENSMUSP00000147777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026555] [ENSMUST00000026557] [ENSMUST00000026558] [ENSMUST00000106049] [ENSMUST00000209320] [ENSMUST00000209690] [ENSMUST00000209766] [ENSMUST00000210708] [ENSMUST00000210710] [ENSMUST00000211527] [ENSMUST00000211590] [ENSMUST00000211624]
Predicted Effect probably benign
Transcript: ENSMUST00000026555
SMART Domains Protein: ENSMUSP00000026555
Gene: ENSMUSG00000025482

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 25 59 3.8e-3 PFAM
Pfam:SHIPPO-rpt 65 95 7.8e-2 PFAM
Pfam:SHIPPO-rpt 100 131 1.2e-7 PFAM
Pfam:SHIPPO-rpt 136 170 3.9e-4 PFAM
Pfam:SHIPPO-rpt 179 209 3e-4 PFAM
Pfam:SHIPPO-rpt 215 245 9.6e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026557
AA Change: I96T

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000026557
Gene: ENSMUSG00000025484
AA Change: I96T

DomainStartEndE-ValueType
Pfam:SNARE 20 82 3.4e-13 PFAM
transmembrane domain 87 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026558
SMART Domains Protein: ENSMUSP00000026558
Gene: ENSMUSG00000025485

DomainStartEndE-ValueType
Pfam:Ric8 66 505 2.3e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106049
SMART Domains Protein: ENSMUSP00000101664
Gene: ENSMUSG00000025482

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 126 157 9.4e-6 PFAM
Pfam:SHIPPO-rpt 162 196 1e-3 PFAM
Pfam:SHIPPO-rpt 241 271 7.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209320
Predicted Effect probably benign
Transcript: ENSMUST00000209690
Predicted Effect probably benign
Transcript: ENSMUST00000209766
Predicted Effect probably benign
Transcript: ENSMUST00000210708
Predicted Effect probably benign
Transcript: ENSMUST00000210710
Predicted Effect possibly damaging
Transcript: ENSMUST00000211527
AA Change: I77T

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect silent
Transcript: ENSMUST00000211590
Predicted Effect probably benign
Transcript: ENSMUST00000211624
AA Change: I73T

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0887 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,504 C3526S probably damaging Het
Adgrf2 T C 17: 42,710,883 N350S probably benign Het
Atp12a G A 14: 56,386,982 probably null Het
AW551984 T G 9: 39,600,659 S19R probably damaging Het
Cfap206 T C 4: 34,711,414 I494M possibly damaging Het
Cog3 A G 14: 75,730,678 I415T probably damaging Het
Col15a1 C T 4: 47,300,518 P1060S probably damaging Het
Ctrb1 A G 8: 111,689,349 V71A possibly damaging Het
Ddhd2 T C 8: 25,752,215 Y211C probably benign Het
Fbxl20 T C 11: 98,109,510 T128A probably benign Het
Fdps A G 3: 89,095,352 probably null Het
Gm4302 TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA 10: 100,341,499 probably benign Het
Gm8369 T A 19: 11,511,836 probably benign Het
Grm6 T C 11: 50,859,774 V588A possibly damaging Het
Heatr6 T C 11: 83,758,341 L174S probably benign Het
Kif1a G A 1: 93,066,137 P364S probably damaging Het
Klk7 A G 7: 43,813,260 D163G probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Lamb3 T C 1: 193,334,861 S787P possibly damaging Het
Lrp5 C T 19: 3,600,753 C1227Y probably damaging Het
Mgst1 G A 6: 138,141,807 probably benign Het
Mllt6 T C 11: 97,680,602 S1022P probably damaging Het
Mtmr2 T C 9: 13,805,382 I521T probably benign Het
Naalad2 T C 9: 18,385,130 T75A possibly damaging Het
Nadsyn1 A T 7: 143,819,108 I83N probably damaging Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neurl4 T A 11: 69,908,510 L904Q probably damaging Het
Ngp A C 9: 110,419,949 I30L probably benign Het
Olfr312 T C 11: 58,832,077 Y308H probably benign Het
Olfr787 G A 10: 129,463,154 M159I probably benign Het
Orm2 A T 4: 63,363,959 M125L probably benign Het
Pax2 A T 19: 44,788,821 D151V possibly damaging Het
Polg A G 7: 79,460,109 V382A probably benign Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Pramef6 T A 4: 143,895,682 I368F probably benign Het
Prss16 A T 13: 22,006,067 V307E probably damaging Het
Prss54 T G 8: 95,564,655 probably null Het
Rspo1 A G 4: 125,007,183 H108R probably benign Het
Sh3bp5l C A 11: 58,346,272 H352N probably damaging Het
Skor1 T C 9: 63,140,354 probably null Het
Smad6 A G 9: 64,012,227 Y289H probably benign Het
Spg11 T C 2: 122,093,443 E799G probably damaging Het
Spg20 G A 3: 55,127,561 G456D probably damaging Het
Tbc1d4 T G 14: 101,608,259 K68Q probably damaging Het
Treml2 A G 17: 48,309,219 M296V probably benign Het
Ugt2b1 C A 5: 86,919,257 D436Y probably damaging Het
Usp9y A T Y: 1,325,042 probably null Homo
Vmn2r6 T C 3: 64,538,159 Y626C probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Zfp131 A G 13: 119,766,593 V506A probably damaging Het
Zfp74 A G 7: 29,934,435 I616T probably benign Het
Other mutations in Bet1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03106:Bet1l APN 7 140854610 missense probably benign 0.13
R5837:Bet1l UTSW 7 140854781 missense probably benign 0.40
R7539:Bet1l UTSW 7 140854544 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATGACAGAGGCAGCTGCAG -3'
(R):5'- AAATCATAGTCAGCTCCGCC -3'

Sequencing Primer
(F):5'- AGAGGCAGCTGCAGTCGTC -3'
(R):5'- CGTCTGCTCTGCTGGGTC -3'
Posted On2018-08-29