Incidental Mutation 'R6827:Ntrk2'
ID534219
Institutional Source Beutler Lab
Gene Symbol Ntrk2
Ensembl Gene ENSMUSG00000055254
Gene Nameneurotrophic tyrosine kinase, receptor, type 2
SynonymsC030027L06Rik, Tkrb, trkB
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R6827 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location58806569-59133970 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59126568 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 753 (W753R)
Ref Sequence ENSEMBL: ENSMUSP00000153553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079828] [ENSMUST00000225488]
Predicted Effect probably damaging
Transcript: ENSMUST00000079828
AA Change: W753R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078757
Gene: ENSMUSG00000055254
AA Change: W753R

DomainStartEndE-ValueType
LRRNT 31 65 1.74e-4 SMART
LRRCT 148 195 8.56e-10 SMART
IGc2 209 273 4.43e-5 SMART
Pfam:I-set 298 377 1.2e-8 PFAM
transmembrane domain 431 453 N/A INTRINSIC
TyrKc 537 806 2.48e-142 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000225488
AA Change: W753R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9631 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation. Mutations in this gene have been associated with obesity and mood disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Different lines of homozygous mice show varied abnormalities including innervation and neural defects, rod defects, impaired ovarian folliculogenesis, and reduced postnatal survival. Homozygotes for a point mutation are normal, but are subject to pharmacological control of signalling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef26 C A 3: 62,423,498 probably null Het
Asb3 A G 11: 31,101,211 N555S probably benign Het
Bcr T C 10: 75,131,064 V501A probably damaging Het
Cchcr1 A G 17: 35,530,405 T773A possibly damaging Het
Dmxl1 C T 18: 49,921,024 P2566S probably damaging Het
Dscam T A 16: 97,038,991 N139Y probably damaging Het
Ephx1 A G 1: 180,989,888 L406P probably damaging Het
Fbxl13 T A 5: 21,522,178 I607F probably damaging Het
Gm35060 C T 18: 32,458,660 W186* probably null Het
Gm3573 T A 14: 42,188,472 T59S probably benign Het
Gm572 T C 4: 148,658,086 L94P possibly damaging Het
Gypa A T 8: 80,504,788 M109L probably benign Het
Hk3 C A 13: 55,011,352 V409L probably damaging Het
Kcnh6 A G 11: 106,009,099 T65A probably benign Het
Kdr G T 5: 75,944,545 P1055Q probably damaging Het
Lef1 T C 3: 131,200,404 probably null Het
Lrrc10 A G 10: 117,045,640 Q73R possibly damaging Het
Moxd1 C T 10: 24,279,850 T284I probably benign Het
Naf1 A T 8: 66,877,691 T290S possibly damaging Het
Naip5 C A 13: 100,245,929 V91L possibly damaging Het
Ncaph2 T C 15: 89,371,327 V568A probably damaging Het
Olfr621-ps1 C A 7: 103,629,825 C45F possibly damaging Het
Pbld1 C A 10: 63,067,433 N96K probably damaging Het
Pcdhac2 G A 18: 37,144,653 V229M probably benign Het
Prrc2b G T 2: 32,200,951 R445L probably benign Het
Scyl2 T C 10: 89,669,804 probably null Het
Sdf2l1 C G 16: 17,132,294 R6P probably benign Het
Slc22a5 A T 11: 53,871,616 I21N possibly damaging Het
Tmem168 A T 6: 13,582,838 F297L probably damaging Het
Trpm4 T C 7: 45,318,628 E293G possibly damaging Het
Trps1 T A 15: 50,822,563 T69S probably benign Het
Ubxn4 T C 1: 128,276,977 M468T probably benign Het
Unc5b C A 10: 60,780,232 R104L probably benign Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Wnt2b A G 3: 104,947,092 V350A probably benign Het
Zfp518b T C 5: 38,671,539 Q1041R probably damaging Het
Zranb1 T C 7: 132,949,745 F68L probably benign Het
Other mutations in Ntrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01928:Ntrk2 APN 13 58846851 missense probably damaging 1.00
IGL02331:Ntrk2 APN 13 58846856 critical splice donor site probably null
IGL02465:Ntrk2 APN 13 59060380 missense probably damaging 1.00
PIT4366001:Ntrk2 UTSW 13 59060335 missense probably damaging 1.00
R0102:Ntrk2 UTSW 13 58808793 missense probably benign 0.00
R0547:Ntrk2 UTSW 13 58874370 missense probably damaging 0.99
R0615:Ntrk2 UTSW 13 59128186 nonsense probably null
R0620:Ntrk2 UTSW 13 58846821 missense probably benign
R1770:Ntrk2 UTSW 13 58861318 missense possibly damaging 0.67
R2063:Ntrk2 UTSW 13 58859297 missense probably damaging 1.00
R2089:Ntrk2 UTSW 13 58859301 missense possibly damaging 0.95
R2091:Ntrk2 UTSW 13 58859301 missense possibly damaging 0.95
R2091:Ntrk2 UTSW 13 58859301 missense possibly damaging 0.95
R2178:Ntrk2 UTSW 13 58808802 missense probably benign 0.06
R2275:Ntrk2 UTSW 13 58861351 missense probably damaging 1.00
R2370:Ntrk2 UTSW 13 59054434 missense probably benign 0.28
R2413:Ntrk2 UTSW 13 58874412 missense possibly damaging 0.56
R2520:Ntrk2 UTSW 13 59054276 intron probably null
R2926:Ntrk2 UTSW 13 59060284 missense probably damaging 1.00
R4163:Ntrk2 UTSW 13 58860240 missense probably damaging 1.00
R4320:Ntrk2 UTSW 13 58860146 missense possibly damaging 0.48
R4348:Ntrk2 UTSW 13 58878259 missense probably damaging 1.00
R4440:Ntrk2 UTSW 13 59060312 missense probably damaging 1.00
R4534:Ntrk2 UTSW 13 59126529 missense probably damaging 1.00
R4695:Ntrk2 UTSW 13 59126493 missense probably damaging 0.99
R5356:Ntrk2 UTSW 13 59060242 missense probably damaging 1.00
R5471:Ntrk2 UTSW 13 58871760 missense probably benign 0.01
R5750:Ntrk2 UTSW 13 58808922 missense probably benign 0.02
R5916:Ntrk2 UTSW 13 58808729 start codon destroyed probably null 0.98
R5972:Ntrk2 UTSW 13 58837819 missense probably damaging 1.00
R6015:Ntrk2 UTSW 13 59060395 missense probably damaging 1.00
R6298:Ntrk2 UTSW 13 58871756 nonsense probably null
R6419:Ntrk2 UTSW 13 58861299 nonsense probably null
R6488:Ntrk2 UTSW 13 58861356 missense possibly damaging 0.93
R6611:Ntrk2 UTSW 13 59054414 missense probably damaging 1.00
R6911:Ntrk2 UTSW 13 58859215 missense probably damaging 1.00
R7387:Ntrk2 UTSW 13 58985979 missense probably damaging 1.00
R7445:Ntrk2 UTSW 13 58846762 missense probably benign 0.03
R7561:Ntrk2 UTSW 13 58861388 missense probably benign 0.31
R8031:Ntrk2 UTSW 13 58874379 missense probably benign
R8044:Ntrk2 UTSW 13 59126499 missense probably damaging 1.00
Z1176:Ntrk2 UTSW 13 58874333 missense probably benign
Z1177:Ntrk2 UTSW 13 58859273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGACACTTCTACTGATGCC -3'
(R):5'- AGCTGGCTCTCTGGAAAGAG -3'

Sequencing Primer
(F):5'- ACTGATGCCTTCCTTGACAGG -3'
(R):5'- TCTCTGGAAAGAGCTGCTGACTC -3'
Posted On2018-09-12