Incidental Mutation 'R6835:Xbp1'
ID534407
Institutional Source Beutler Lab
Gene Symbol Xbp1
Ensembl Gene ENSMUSG00000020484
Gene NameX-box binding protein 1
SynonymsXBP-1, D11Ertd39e, TREB-5, TREB5
MMRRC Submission
Accession Numbers

Genbank: NM_013842; MGI: 98970; Ensembl: ENSMUST00000109866

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6835 (G1)
Quality Score188.009
Status Validated
Chromosome11
Chromosomal Location5520659-5525893 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) A to G at 5521809 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063084] [ENSMUST00000149623]
Predicted Effect probably benign
Transcript: ENSMUST00000063084
SMART Domains Protein: ENSMUSP00000054852
Gene: ENSMUSG00000020484

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
BRLZ 61 125 9.12e-18 SMART
low complexity region 185 198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149159
SMART Domains Protein: ENSMUSP00000134088
Gene: ENSMUSG00000020484

DomainStartEndE-ValueType
BRLZ 2 57 2.62e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149623
SMART Domains Protein: ENSMUSP00000135768
Gene: ENSMUSG00000020484

DomainStartEndE-ValueType
BRLZ 11 72 3.68e-13 SMART
low complexity region 132 145 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that regulates MHC class II genes by binding to a promoter element referred to as an X box. This gene product is a bZIP protein, which was also identified as a cellular transcription factor that binds to an enhancer in the promoter of the T cell leukemia virus type 1 promoter. It may increase expression of viral proteins by acting as the DNA binding partner of a viral transactivator. It has been found that upon accumulation of unfolded proteins in the endoplasmic reticulum (ER), the mRNA of this gene is processed to an active form by an unconventional splicing mechanism that is mediated by the endonuclease inositol-requiring enzyme 1 (IRE1). The resulting loss of 26 nt from the spliced mRNA causes a frame-shift and an isoform XBP1(S), which is the functionally active transcription factor. The isoform encoded by the unspliced mRNA, XBP1(U), is constitutively expressed, and thought to function as a negative feedback regulator of XBP1(S), which shuts off transcription of target genes during the recovery phase of ER stress. A pseudogene of XBP1 has been identified and localized to chromosome 5. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit markedly impaired liver development resulting in severe anemia, necrosis of cardiac myocytes, morphological abnormalities of the neural tube, and fetal death around embryonic day 14. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(3) Targeted, other(6) Gene trapped(7)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,930,562 R695G probably benign Het
Arhgef4 A G 1: 34,806,493 H1533R probably damaging Het
Birc6 T C 17: 74,642,504 L3120P probably damaging Het
Cfap46 T A 7: 139,652,498 I850F probably damaging Het
Crym A C 7: 120,186,645 S311A probably benign Het
Cttn T C 7: 144,456,497 probably null Het
Dtnb C T 12: 3,632,841 probably benign Het
Edem1 T C 6: 108,854,399 V607A probably benign Het
Etfa A G 9: 55,495,819 V64A probably benign Het
Fam133b A G 5: 3,554,732 T40A possibly damaging Het
Fmn2 C A 1: 174,699,669 D1442E probably damaging Het
Gpi1 T C 7: 34,227,138 K128E possibly damaging Het
Gpr179 A T 11: 97,347,467 F310L probably damaging Het
Hdac7 T A 15: 97,802,747 H531L probably damaging Het
Hfm1 G A 5: 106,878,815 R145* probably null Het
Hsp90b1 A T 10: 86,694,085 D573E probably damaging Het
Hunk T G 16: 90,472,524 W243G probably damaging Het
Icam1 G T 9: 21,027,125 G327W possibly damaging Het
Ino80d C A 1: 63,074,326 A322S probably benign Het
Itpkc A C 7: 27,227,815 S225A probably benign Het
Krt75 C T 15: 101,571,037 R286Q probably benign Het
Lmnb2 A G 10: 80,909,960 L95P probably damaging Het
Mns1 T C 9: 72,452,744 M392T probably damaging Het
Morc3 A T 16: 93,847,421 N200I probably damaging Het
Mrvi1 T G 7: 110,921,334 E278A probably damaging Het
Myadm T C 7: 3,297,676 V318A possibly damaging Het
Nt5dc1 A C 10: 34,310,379 S398A probably benign Het
Olfr155 T C 4: 43,854,912 V201A probably benign Het
Olfr391-ps A G 11: 73,799,235 I174T possibly damaging Het
Pcdhga2 T C 18: 37,670,789 I562T probably damaging Het
Pcdhgb1 T A 18: 37,680,500 C15S probably benign Het
Pikfyve T G 1: 65,258,843 L1532R probably damaging Het
Rdh7 T A 10: 127,884,739 T255S probably benign Het
Rtel1 A G 2: 181,355,953 T1165A probably benign Het
Sdk2 C T 11: 113,830,048 A1352T probably damaging Het
Strip2 T C 6: 29,941,917 S629P probably damaging Het
Taf5 A G 19: 47,077,337 T494A possibly damaging Het
Tek T G 4: 94,853,434 N809K possibly damaging Het
Tmbim7 A T 5: 3,661,943 T63S probably benign Het
Utrn A T 10: 12,727,764 L624Q probably damaging Het
Zbp1 T A 2: 173,213,911 probably null Het
Zfp112 T C 7: 24,125,806 C400R probably damaging Het
Zfp202 C T 9: 40,210,235 probably null Het
Zfp747 T C 7: 127,374,047 E317G possibly damaging Het
Other mutations in Xbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1601:Xbp1 UTSW 11 5521975 missense probably damaging 1.00
R2256:Xbp1 UTSW 11 5524841 missense probably damaging 1.00
R4647:Xbp1 UTSW 11 5522006 missense probably damaging 1.00
R4782:Xbp1 UTSW 11 5521167 missense probably damaging 1.00
R4964:Xbp1 UTSW 11 5521125 missense probably damaging 0.98
R5367:Xbp1 UTSW 11 5521910 missense probably benign
R5718:Xbp1 UTSW 11 5521903 missense probably benign 0.00
R5928:Xbp1 UTSW 11 5523514 intron probably benign
R6038:Xbp1 UTSW 11 5524798 missense probably benign 0.00
R6038:Xbp1 UTSW 11 5524798 missense probably benign 0.00
R6492:Xbp1 UTSW 11 5521005 missense probably benign
R6955:Xbp1 UTSW 11 5522018 missense probably null 0.97
R7067:Xbp1 UTSW 11 5524275 missense probably damaging 1.00
R7483:Xbp1 UTSW 11 5521098 missense probably benign 0.02
R7502:Xbp1 UTSW 11 5524683 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTGGACCCAGAAAGTAGCGG -3'
(R):5'- ATGGCCTGAAGTCCCTTTAC -3'

Sequencing Primer
(F):5'- CCCAGAAAGTAGCGGGGGAG -3'
(R):5'- AAATCCACCACTTGCTGCTC -3'
Posted On2018-09-12