Incidental Mutation 'R6835:Mrvi1'
ID534393
Institutional Source Beutler Lab
Gene Symbol Mrvi1
Ensembl Gene ENSMUSG00000005611
Gene NameMRV integration site 1
SynonymsRis1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R6835 (G1)
Quality Score209.009
Status Validated
Chromosome7
Chromosomal Location110868266-110982461 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 110921334 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 278 (E278A)
Ref Sequence ENSEMBL: ENSMUSP00000120045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005751] [ENSMUST00000125758] [ENSMUST00000127935]
Predicted Effect probably damaging
Transcript: ENSMUST00000005751
AA Change: E419A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005751
Gene: ENSMUSG00000005611
AA Change: E419A

DomainStartEndE-ValueType
low complexity region 98 113 N/A INTRINSIC
low complexity region 138 160 N/A INTRINSIC
Pfam:MRVI1 265 856 1.8e-227 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125758
AA Change: E484A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114578
Gene: ENSMUSG00000005611
AA Change: E484A

DomainStartEndE-ValueType
low complexity region 163 178 N/A INTRINSIC
low complexity region 203 225 N/A INTRINSIC
Pfam:MRVI1 336 921 1.5e-202 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127935
AA Change: E278A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120045
Gene: ENSMUSG00000005611
AA Change: E278A

DomainStartEndE-ValueType
Pfam:MRVI1 124 715 7.9e-228 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: This gene is a putative tumor suppressor gene that is frequently disrupted by mouse AIDS-related virus (MRV). The encoded protein participates in signaling by nitric oxide (NO) to inhibit intracellular calcium release and platelet aggregation in cardiovascular tissue. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show lower blood pressure, a slightly reduced heart rate, and failure of cGMP-mediated relaxation of receptor-triggered smooth muscle contraction; 50% of mice die prematurely with an enlarged stomach, a dilated cecum, pyloric stenosis and impaired GI motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,930,562 R695G probably benign Het
Arhgef4 A G 1: 34,806,493 H1533R probably damaging Het
Birc6 T C 17: 74,642,504 L3120P probably damaging Het
Cfap46 T A 7: 139,652,498 I850F probably damaging Het
Crym A C 7: 120,186,645 S311A probably benign Het
Cttn T C 7: 144,456,497 probably null Het
Dtnb C T 12: 3,632,841 probably benign Het
Edem1 T C 6: 108,854,399 V607A probably benign Het
Etfa A G 9: 55,495,819 V64A probably benign Het
Fam133b A G 5: 3,554,732 T40A possibly damaging Het
Fmn2 C A 1: 174,699,669 D1442E probably damaging Het
Gpi1 T C 7: 34,227,138 K128E possibly damaging Het
Gpr179 A T 11: 97,347,467 F310L probably damaging Het
Hdac7 T A 15: 97,802,747 H531L probably damaging Het
Hfm1 G A 5: 106,878,815 R145* probably null Het
Hsp90b1 A T 10: 86,694,085 D573E probably damaging Het
Hunk T G 16: 90,472,524 W243G probably damaging Het
Icam1 G T 9: 21,027,125 G327W possibly damaging Het
Ino80d C A 1: 63,074,326 A322S probably benign Het
Itpkc A C 7: 27,227,815 S225A probably benign Het
Krt75 C T 15: 101,571,037 R286Q probably benign Het
Lmnb2 A G 10: 80,909,960 L95P probably damaging Het
Mns1 T C 9: 72,452,744 M392T probably damaging Het
Morc3 A T 16: 93,847,421 N200I probably damaging Het
Myadm T C 7: 3,297,676 V318A possibly damaging Het
Nt5dc1 A C 10: 34,310,379 S398A probably benign Het
Olfr155 T C 4: 43,854,912 V201A probably benign Het
Olfr391-ps A G 11: 73,799,235 I174T possibly damaging Het
Pcdhga2 T C 18: 37,670,789 I562T probably damaging Het
Pcdhgb1 T A 18: 37,680,500 C15S probably benign Het
Pikfyve T G 1: 65,258,843 L1532R probably damaging Het
Rdh7 T A 10: 127,884,739 T255S probably benign Het
Rtel1 A G 2: 181,355,953 T1165A probably benign Het
Sdk2 C T 11: 113,830,048 A1352T probably damaging Het
Strip2 T C 6: 29,941,917 S629P probably damaging Het
Taf5 A G 19: 47,077,337 T494A possibly damaging Het
Tek T G 4: 94,853,434 N809K possibly damaging Het
Tmbim7 A T 5: 3,661,943 T63S probably benign Het
Utrn A T 10: 12,727,764 L624Q probably damaging Het
Xbp1 A G 11: 5,521,809 probably benign Het
Zbp1 T A 2: 173,213,911 probably null Het
Zfp112 T C 7: 24,125,806 C400R probably damaging Het
Zfp202 C T 9: 40,210,235 probably null Het
Zfp747 T C 7: 127,374,047 E317G possibly damaging Het
Other mutations in Mrvi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Mrvi1 APN 7 110945967 missense possibly damaging 0.64
IGL01384:Mrvi1 APN 7 110926501 missense possibly damaging 0.89
IGL01474:Mrvi1 APN 7 110871433 missense possibly damaging 0.65
IGL02081:Mrvi1 APN 7 110924074 critical splice acceptor site probably null
IGL02193:Mrvi1 APN 7 110898955 missense probably damaging 1.00
IGL02537:Mrvi1 APN 7 110871473 nonsense probably null
IGL03084:Mrvi1 APN 7 110885829 splice site probably benign
IGL03264:Mrvi1 APN 7 110926346 missense probably benign 0.00
hurricane UTSW 7 110923963 missense probably benign 0.09
R0346:Mrvi1 UTSW 7 110898976 missense probably damaging 1.00
R0401:Mrvi1 UTSW 7 110876897 missense probably benign 0.09
R0731:Mrvi1 UTSW 7 110876900 missense probably benign 0.00
R1168:Mrvi1 UTSW 7 110895931 missense probably damaging 1.00
R1342:Mrvi1 UTSW 7 110888045 missense probably benign 0.07
R1887:Mrvi1 UTSW 7 110924533 critical splice donor site probably null
R2183:Mrvi1 UTSW 7 110898982 missense probably damaging 1.00
R3417:Mrvi1 UTSW 7 110876954 missense possibly damaging 0.90
R3736:Mrvi1 UTSW 7 110923963 missense probably benign 0.09
R4063:Mrvi1 UTSW 7 110923777 missense probably benign 0.38
R4436:Mrvi1 UTSW 7 110876917 missense probably damaging 1.00
R4523:Mrvi1 UTSW 7 110923841 missense probably benign 0.02
R4948:Mrvi1 UTSW 7 110888029 missense probably damaging 1.00
R5070:Mrvi1 UTSW 7 110925312 missense probably benign
R5085:Mrvi1 UTSW 7 110871493 missense probably damaging 1.00
R5605:Mrvi1 UTSW 7 110946002 missense possibly damaging 0.85
R6194:Mrvi1 UTSW 7 110899694 missense probably damaging 1.00
R6218:Mrvi1 UTSW 7 110876905 missense probably benign 0.00
R6273:Mrvi1 UTSW 7 110871583 missense probably benign 0.01
R6608:Mrvi1 UTSW 7 110888551 missense probably damaging 1.00
R6754:Mrvi1 UTSW 7 110929512 missense probably damaging 1.00
R7064:Mrvi1 UTSW 7 110895854 missense probably damaging 1.00
R7304:Mrvi1 UTSW 7 110899724 missense possibly damaging 0.77
R7412:Mrvi1 UTSW 7 110923756 missense probably benign 0.06
R7420:Mrvi1 UTSW 7 110871473 nonsense probably null
X0065:Mrvi1 UTSW 7 110924044 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GCTCTGCCTCAGTGGACTATAC -3'
(R):5'- CACTTACACAGAAGGGCAGG -3'

Sequencing Primer
(F):5'- GCCTCAGTGGACTATACAATCTG -3'
(R):5'- GCAGTGAGACCATCAAGAATTACTTC -3'
Posted On2018-09-12