Incidental Mutation 'R6892:Cyp3a11'
ID538099
Institutional Source Beutler Lab
Gene Symbol Cyp3a11
Ensembl Gene ENSMUSG00000056035
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 11
SynonymsIIIAm1, Cyp3a, Pcn
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6892 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location145854426-145879964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 145860448 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 374 (L374F)
Ref Sequence ENSEMBL: ENSMUSP00000037665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035918]
Predicted Effect probably damaging
Transcript: ENSMUST00000035918
AA Change: L374F

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037665
Gene: ENSMUSG00000056035
AA Change: L374F

DomainStartEndE-ValueType
Pfam:p450 38 494 2.4e-136 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A G 17: 23,712,354 L193P probably damaging Het
4930442H23Rik C A 10: 81,183,144 probably benign Het
4933421I07Rik T C 7: 42,446,407 Q139R probably benign Het
A930002H24Rik C T 17: 63,863,764 V10M unknown Het
Acvr2a T A 2: 48,897,075 L394Q probably damaging Het
Ano6 T C 15: 95,967,624 Y830H probably damaging Het
Atp8b4 T A 2: 126,343,002 I914F possibly damaging Het
Cab39 A G 1: 85,848,377 D265G probably damaging Het
Capn5 A T 7: 98,135,941 W109R probably damaging Het
Cdk18 G T 1: 132,122,110 T44K probably benign Het
Cdt1 T A 8: 122,570,212 N248K probably damaging Het
Cpa4 G T 6: 30,583,629 R248L probably benign Het
Cpt1a G A 19: 3,371,660 V481M probably benign Het
Dcdc2a A G 13: 25,056,460 N64D probably damaging Het
Dmxl1 G A 18: 49,920,902 R2525Q probably damaging Het
Dscaml1 G A 9: 45,683,830 V744M probably damaging Het
Dync1h1 G A 12: 110,638,901 E2391K probably benign Het
Ezh1 A T 11: 101,199,361 Y522* probably null Het
Fzd3 G C 14: 65,209,881 A533G possibly damaging Het
Gm14403 T G 2: 177,509,247 C329G probably damaging Het
Gm17067 A C 7: 42,710,675 probably null Het
Gm38119 A G 3: 92,738,222 C22R unknown Het
Gtf3c3 A G 1: 54,415,941 S588P probably benign Het
Ift140 A G 17: 25,020,546 E59G possibly damaging Het
Ints1 A T 5: 139,767,828 M683K probably damaging Het
Iws1 A G 18: 32,086,274 M470V probably damaging Het
Mptx1 A G 1: 174,332,265 R46G probably benign Het
Nhsl1 C T 10: 18,524,343 T439I probably damaging Het
Olfr517 A G 7: 108,868,515 L213P probably damaging Het
Peg3 C T 7: 6,708,899 S1108N possibly damaging Het
Pgm2 A G 4: 99,929,708 E48G probably benign Het
Pkhd1 G A 1: 20,523,515 T1458I probably damaging Het
Polr1a A T 6: 71,964,712 D1068V possibly damaging Het
Ptprq T C 10: 107,576,004 T1834A probably benign Het
Rapgef1 T C 2: 29,699,840 probably null Het
Rgl1 A T 1: 152,539,940 D409E probably benign Het
Rgsl1 G T 1: 153,821,499 Y558* probably null Het
Rock1 C T 18: 10,122,612 R403H probably benign Het
Scn11a T A 9: 119,806,969 D304V possibly damaging Het
Sdk1 A T 5: 142,046,298 I1043F probably benign Het
Sgms2 A G 3: 131,342,154 Y24H probably benign Het
Sppl2a A G 2: 126,913,575 I372T probably damaging Het
Sptbn1 A G 11: 30,142,187 M526T probably benign Het
Stxbp5l A T 16: 37,188,629 S683T possibly damaging Het
Syk A T 13: 52,632,898 R332S probably benign Het
Syne2 T A 12: 75,962,528 V2401E probably damaging Het
Tarm1 T C 7: 3,497,490 Y87C probably damaging Het
Tbc1d22b A G 17: 29,595,890 K378E possibly damaging Het
Tcte1 A G 17: 45,533,157 T20A probably benign Het
Tor1aip2 A T 1: 156,065,181 Y411F possibly damaging Het
Trim43c T A 9: 88,844,924 M267K probably benign Het
Ubr2 T G 17: 46,934,108 Y1664S probably damaging Het
Uhrf1bp1l G A 10: 89,805,123 V719I probably benign Het
Vmn1r41 C A 6: 89,747,181 Q235K possibly damaging Het
Wdr17 T C 8: 54,673,596 T401A probably damaging Het
Zfp454 A G 11: 50,873,198 L469P probably damaging Het
Other mutations in Cyp3a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Cyp3a11 APN 5 145862465 missense probably damaging 1.00
IGL01316:Cyp3a11 APN 5 145855151 missense possibly damaging 0.78
IGL01348:Cyp3a11 APN 5 145869007 missense possibly damaging 0.80
IGL01591:Cyp3a11 APN 5 145875481 splice site probably benign
IGL01665:Cyp3a11 APN 5 145868665 missense probably benign 0.00
IGL02203:Cyp3a11 APN 5 145869166 missense probably damaging 1.00
IGL02894:Cyp3a11 APN 5 145869026 nonsense probably null
IGL03201:Cyp3a11 APN 5 145860379 missense possibly damaging 0.94
IGL03342:Cyp3a11 APN 5 145855117 missense probably damaging 0.96
PIT4486001:Cyp3a11 UTSW 5 145860492 missense probably damaging 0.99
R0347:Cyp3a11 UTSW 5 145865925 missense possibly damaging 0.93
R0376:Cyp3a11 UTSW 5 145862452 nonsense probably null
R0378:Cyp3a11 UTSW 5 145868607 missense probably benign 0.43
R0448:Cyp3a11 UTSW 5 145862394 missense probably benign 0.00
R0567:Cyp3a11 UTSW 5 145869149 missense probably damaging 1.00
R0968:Cyp3a11 UTSW 5 145862514 splice site probably benign
R1292:Cyp3a11 UTSW 5 145865994 missense probably benign 0.04
R1400:Cyp3a11 UTSW 5 145862489 missense probably damaging 0.98
R1478:Cyp3a11 UTSW 5 145858771 missense probably benign 0.01
R1520:Cyp3a11 UTSW 5 145862453 missense probably damaging 1.00
R1716:Cyp3a11 UTSW 5 145868966 missense probably benign
R2060:Cyp3a11 UTSW 5 145855081 missense probably benign 0.00
R2076:Cyp3a11 UTSW 5 145879766 missense probably benign
R2227:Cyp3a11 UTSW 5 145868547 missense possibly damaging 0.90
R3725:Cyp3a11 UTSW 5 145866000 missense probably benign 0.02
R4222:Cyp3a11 UTSW 5 145860466 missense probably damaging 0.99
R4256:Cyp3a11 UTSW 5 145869195 missense probably benign 0.04
R4294:Cyp3a11 UTSW 5 145869195 missense probably benign 0.04
R4852:Cyp3a11 UTSW 5 145860495 missense probably damaging 1.00
R5229:Cyp3a11 UTSW 5 145855135 missense probably benign 0.00
R5285:Cyp3a11 UTSW 5 145855083 missense probably benign 0.00
R5590:Cyp3a11 UTSW 5 145865977 missense probably benign 0.00
R5703:Cyp3a11 UTSW 5 145860373 missense probably benign
R5786:Cyp3a11 UTSW 5 145862474 missense possibly damaging 0.47
R6291:Cyp3a11 UTSW 5 145862427 missense possibly damaging 0.89
R6405:Cyp3a11 UTSW 5 145862420 missense probably damaging 0.96
R7114:Cyp3a11 UTSW 5 145858783 missense probably benign 0.16
R7243:Cyp3a11 UTSW 5 145858803 missense probably damaging 0.96
R7438:Cyp3a11 UTSW 5 145865900 missense probably benign 0.39
R7611:Cyp3a11 UTSW 5 145860381 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AGAGACATCATAGTATCCACAGGC -3'
(R):5'- CCTTTGAGCTGCGGAACTTG -3'

Sequencing Primer
(F):5'- TAGTATCCACAGGCTTGCAG -3'
(R):5'- AGCTGCGGAACTTGACTTTG -3'
Posted On2018-11-06