Incidental Mutation 'R6959:Mfsd11'
ID 541666
Institutional Source Beutler Lab
Gene Symbol Mfsd11
Ensembl Gene ENSMUSG00000020818
Gene Name major facilitator superfamily domain containing 11
Synonyms 2600014M03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock # R6959 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 116852440-116875635 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 116861669 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021173] [ENSMUST00000106363] [ENSMUST00000106365] [ENSMUST00000136012] [ENSMUST00000139954] [ENSMUST00000153084]
AlphaFold Q8BJ51
Predicted Effect probably null
Transcript: ENSMUST00000021173
SMART Domains Protein: ENSMUSP00000021173
Gene: ENSMUSG00000020818

DomainStartEndE-ValueType
Pfam:UNC-93 14 166 6.5e-56 PFAM
transmembrane domain 173 190 N/A INTRINSIC
transmembrane domain 239 261 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
transmembrane domain 305 327 N/A INTRINSIC
transmembrane domain 410 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106363
SMART Domains Protein: ENSMUSP00000101971
Gene: ENSMUSG00000020818

DomainStartEndE-ValueType
Pfam:UNC-93 14 92 6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106365
SMART Domains Protein: ENSMUSP00000101973
Gene: ENSMUSG00000020818

DomainStartEndE-ValueType
Pfam:UNC-93 14 91 7.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136012
SMART Domains Protein: ENSMUSP00000118203
Gene: ENSMUSG00000020818

DomainStartEndE-ValueType
Pfam:UNC-93 14 91 7.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139954
SMART Domains Protein: ENSMUSP00000118112
Gene: ENSMUSG00000020818

DomainStartEndE-ValueType
Pfam:UNC-93 14 91 7.9e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000153084
SMART Domains Protein: ENSMUSP00000123368
Gene: ENSMUSG00000020818

DomainStartEndE-ValueType
Pfam:UNC-93 14 115 7.4e-33 PFAM
transmembrane domain 119 138 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
transmembrane domain 224 246 N/A INTRINSIC
transmembrane domain 253 275 N/A INTRINSIC
transmembrane domain 358 380 N/A INTRINSIC
Meta Mutation Damage Score 0.9503 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency 94% (61/65)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik G A 11: 70,616,659 G177R probably damaging Het
4932438A13Rik T G 3: 36,967,189 V2154G probably damaging Het
Arhgef12 T C 9: 43,015,953 T292A probably benign Het
Atp11a T A 8: 12,820,467 D173E probably damaging Het
Btnl2 G A 17: 34,363,359 V300M possibly damaging Het
Calcrl A T 2: 84,370,084 N117K possibly damaging Het
Ccl22 A T 8: 94,746,900 probably null Het
Cd200r1 T A 16: 44,790,176 S216T probably damaging Het
Cdk5rap2 G A 4: 70,360,669 probably null Het
Cfap157 A G 2: 32,784,248 I47T probably damaging Het
Chodl G A 16: 78,946,684 V220I probably damaging Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Cstf3 A G 2: 104,649,462 T225A probably benign Het
Duoxa1 T C 2: 122,303,837 S267G probably damaging Het
Epb41l1 G A 2: 156,499,587 S164N probably benign Het
Fam126a T C 5: 23,991,756 I45V possibly damaging Het
Fat3 T C 9: 15,996,885 D2607G possibly damaging Het
Galnt5 A G 2: 57,999,219 D277G probably benign Het
Galnt6 A G 15: 100,714,125 I212T probably damaging Het
Gatsl2 T C 5: 134,135,213 S83P probably damaging Het
Gm45861 T C 8: 27,548,185 probably null Het
Gm5478 T C 15: 101,645,448 D243G probably damaging Het
Gm6657 A G 12: 78,202,296 K139E probably damaging Het
Gm7682 T A 5: 94,447,032 N250K possibly damaging Het
Gse1 A G 8: 120,570,971 probably benign Het
Hspg2 A T 4: 137,519,289 Q1096L probably benign Het
Idh3b A G 2: 130,281,527 V181A probably damaging Het
Igf2bp3 T C 6: 49,117,148 probably null Het
Ikzf2 A G 1: 69,538,770 *382Q probably null Het
Impg2 A C 16: 56,268,330 H1073P probably benign Het
Incenp T C 19: 9,876,770 E639G unknown Het
Kcne4 A G 1: 78,817,886 M84V probably benign Het
Ktn1 T A 14: 47,720,256 F1004I probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Malrd1 A G 2: 16,218,009 I2040V probably damaging Het
Mau2 T C 8: 70,033,228 D110G probably damaging Het
Mei1 T C 15: 82,124,875 V1237A probably benign Het
Ncapd2 A G 6: 125,168,920 F1293L probably benign Het
Nf1 A G 11: 79,549,468 T280A probably damaging Het
Obscn G T 11: 59,037,585 A6085E probably damaging Het
Olfr623 T A 7: 103,660,843 I136F probably damaging Het
Pdzd2 C T 15: 12,375,907 A1381T probably benign Het
Ralgapa2 A G 2: 146,342,701 V1462A probably damaging Het
Rbx1 T A 15: 81,470,962 C56* probably null Het
Reln A G 5: 21,976,564 S1774P probably damaging Het
Ros1 T A 10: 52,163,994 E300D probably damaging Het
Sarnp T C 10: 128,848,268 V111A possibly damaging Het
Scube1 G T 15: 83,629,435 Q345K probably benign Het
Slc18b1 A G 10: 23,826,044 probably null Het
Slc37a2 T A 9: 37,241,334 T64S probably benign Het
Slit2 A G 5: 48,238,385 D710G possibly damaging Het
Srp72 T A 5: 76,994,223 Y375N possibly damaging Het
Tmco4 T A 4: 139,010,499 V135D probably damaging Het
Trim62 A G 4: 128,909,162 D335G probably damaging Het
Tsfm T C 10: 127,022,909 M196V probably benign Het
Tspan10 T A 11: 120,444,696 C211S probably damaging Het
Ttc21b A T 2: 66,231,312 M498K probably benign Het
Ttc6 A T 12: 57,658,142 probably null Het
Ttll1 G T 15: 83,502,196 Y69* probably null Het
Usp28 T A 9: 49,001,542 L31H probably damaging Het
Vmn2r86 A G 10: 130,446,531 S739P probably damaging Het
Wdr64 T A 1: 175,705,989 F64I probably damaging Het
Ywhaq A G 12: 21,396,280 probably null Het
Zfr T C 15: 12,150,323 S459P probably damaging Het
Other mutations in Mfsd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Mfsd11 APN 11 116858496 missense probably benign 0.39
IGL00809:Mfsd11 APN 11 116859351 missense probably damaging 0.97
IGL01999:Mfsd11 APN 11 116861585 missense probably damaging 0.99
IGL02182:Mfsd11 APN 11 116873914 missense possibly damaging 0.50
IGL02582:Mfsd11 APN 11 116873875 missense probably damaging 0.99
IGL02794:Mfsd11 APN 11 116859351 missense probably damaging 0.97
R0416:Mfsd11 UTSW 11 116865882 splice site probably benign
R1229:Mfsd11 UTSW 11 116873297 missense probably damaging 1.00
R1397:Mfsd11 UTSW 11 116873297 missense probably damaging 1.00
R1929:Mfsd11 UTSW 11 116873914 missense probably benign 0.00
R2081:Mfsd11 UTSW 11 116861555 missense possibly damaging 0.92
R4554:Mfsd11 UTSW 11 116861580 missense probably damaging 0.97
R5888:Mfsd11 UTSW 11 116871384 missense probably damaging 1.00
R7807:Mfsd11 UTSW 11 116863907 missense probably benign
R7990:Mfsd11 UTSW 11 116859497 missense possibly damaging 0.84
R8073:Mfsd11 UTSW 11 116863923 missense probably benign
R8692:Mfsd11 UTSW 11 116861617 missense probably benign
R8851:Mfsd11 UTSW 11 116861653 missense probably benign
R8887:Mfsd11 UTSW 11 116854700 critical splice donor site probably null
R8954:Mfsd11 UTSW 11 116859336 missense probably damaging 0.98
R9151:Mfsd11 UTSW 11 116859497 missense
R9318:Mfsd11 UTSW 11 116859572 missense probably damaging 1.00
R9389:Mfsd11 UTSW 11 116873335 missense probably benign
X0018:Mfsd11 UTSW 11 116854085 missense probably benign 0.21
Z1176:Mfsd11 UTSW 11 116863940 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTCACGGGCATTGTCTC -3'
(R):5'- TCATCTGACAGCTGGGGAAG -3'

Sequencing Primer
(F):5'- TCACGGGCATTGTCTCACAGG -3'
(R):5'- GGGGATCTTTCACAGCCTC -3'
Posted On 2018-11-28