Incidental Mutation 'R6959:Igf2bp3'
ID 568358
Institutional Source Beutler Lab
Gene Symbol Igf2bp3
Ensembl Gene ENSMUSG00000029814
Gene Name insulin-like growth factor 2 mRNA binding protein 3
Synonyms IMP3, 2610101N11Rik, Koc13
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6959 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 49085223-49214957 bp(-) (GRCm38)
Type of Mutation splice site (4 bp from exon)
DNA Base Change (assembly) T to C at 49117148 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031838]
AlphaFold Q9CPN8
Predicted Effect probably null
Transcript: ENSMUST00000031838
SMART Domains Protein: ENSMUSP00000031838
Gene: ENSMUSG00000029814

DomainStartEndE-ValueType
RRM 3 71 1.96e-8 SMART
RRM 82 152 3.92e-8 SMART
low complexity region 164 182 N/A INTRINSIC
KH 194 265 3.01e-11 SMART
KH 275 348 1.51e-16 SMART
low complexity region 377 398 N/A INTRINSIC
KH 404 475 2.16e-12 SMART
KH 486 558 1.66e-13 SMART
low complexity region 559 570 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency 94% (61/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is primarily found in the nucleolus, where it can bind to the 5' UTR of the insulin-like growth factor II leader 3 mRNA and may repress translation of insulin-like growth factor II during late development. The encoded protein contains several KH domains, which are important in RNA binding and are known to be involved in RNA synthesis and metabolism. A pseudogene exists on chromosome 7, and there are putative pseudogenes on other chromosomes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik G A 11: 70,616,659 G177R probably damaging Het
4932438A13Rik T G 3: 36,967,189 V2154G probably damaging Het
Arhgef12 T C 9: 43,015,953 T292A probably benign Het
Atp11a T A 8: 12,820,467 D173E probably damaging Het
Btnl2 G A 17: 34,363,359 V300M possibly damaging Het
Calcrl A T 2: 84,370,084 N117K possibly damaging Het
Ccl22 A T 8: 94,746,900 probably null Het
Cd200r1 T A 16: 44,790,176 S216T probably damaging Het
Cdk5rap2 G A 4: 70,360,669 probably null Het
Cfap157 A G 2: 32,784,248 I47T probably damaging Het
Chodl G A 16: 78,946,684 V220I probably damaging Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Cstf3 A G 2: 104,649,462 T225A probably benign Het
Duoxa1 T C 2: 122,303,837 S267G probably damaging Het
Epb41l1 G A 2: 156,499,587 S164N probably benign Het
Fam126a T C 5: 23,991,756 I45V possibly damaging Het
Fat3 T C 9: 15,996,885 D2607G possibly damaging Het
Galnt5 A G 2: 57,999,219 D277G probably benign Het
Galnt6 A G 15: 100,714,125 I212T probably damaging Het
Gatsl2 T C 5: 134,135,213 S83P probably damaging Het
Gm45861 T C 8: 27,548,185 probably null Het
Gm5478 T C 15: 101,645,448 D243G probably damaging Het
Gm6657 A G 12: 78,202,296 K139E probably damaging Het
Gm7682 T A 5: 94,447,032 N250K possibly damaging Het
Gse1 A G 8: 120,570,971 probably benign Het
Hspg2 A T 4: 137,519,289 Q1096L probably benign Het
Idh3b A G 2: 130,281,527 V181A probably damaging Het
Ikzf2 A G 1: 69,538,770 *382Q probably null Het
Impg2 A C 16: 56,268,330 H1073P probably benign Het
Incenp T C 19: 9,876,770 E639G unknown Het
Kcne4 A G 1: 78,817,886 M84V probably benign Het
Ktn1 T A 14: 47,720,256 F1004I probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Malrd1 A G 2: 16,218,009 I2040V probably damaging Het
Mau2 T C 8: 70,033,228 D110G probably damaging Het
Mei1 T C 15: 82,124,875 V1237A probably benign Het
Mfsd11 T G 11: 116,861,669 probably null Het
Ncapd2 A G 6: 125,168,920 F1293L probably benign Het
Nf1 A G 11: 79,549,468 T280A probably damaging Het
Obscn G T 11: 59,037,585 A6085E probably damaging Het
Olfr623 T A 7: 103,660,843 I136F probably damaging Het
Pdzd2 C T 15: 12,375,907 A1381T probably benign Het
Ralgapa2 A G 2: 146,342,701 V1462A probably damaging Het
Rbx1 T A 15: 81,470,962 C56* probably null Het
Reln A G 5: 21,976,564 S1774P probably damaging Het
Ros1 T A 10: 52,163,994 E300D probably damaging Het
Sarnp T C 10: 128,848,268 V111A possibly damaging Het
Scube1 G T 15: 83,629,435 Q345K probably benign Het
Slc18b1 A G 10: 23,826,044 probably null Het
Slc37a2 T A 9: 37,241,334 T64S probably benign Het
Slit2 A G 5: 48,238,385 D710G possibly damaging Het
Srp72 T A 5: 76,994,223 Y375N possibly damaging Het
Tmco4 T A 4: 139,010,499 V135D probably damaging Het
Trim62 A G 4: 128,909,162 D335G probably damaging Het
Tsfm T C 10: 127,022,909 M196V probably benign Het
Tspan10 T A 11: 120,444,696 C211S probably damaging Het
Ttc21b A T 2: 66,231,312 M498K probably benign Het
Ttc6 A T 12: 57,658,142 probably null Het
Ttll1 G T 15: 83,502,196 Y69* probably null Het
Usp28 T A 9: 49,001,542 L31H probably damaging Het
Vmn2r86 A G 10: 130,446,531 S739P probably damaging Het
Wdr64 T A 1: 175,705,989 F64I probably damaging Het
Ywhaq A G 12: 21,396,280 probably null Het
Zfr T C 15: 12,150,323 S459P probably damaging Het
Other mutations in Igf2bp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02199:Igf2bp3 APN 6 49088524 missense probably benign 0.02
IGL02473:Igf2bp3 APN 6 49094229 missense probably benign 0.03
IGL02957:Igf2bp3 APN 6 49087404 missense probably benign 0.28
bittie UTSW 6 49107428 missense possibly damaging 0.61
bump UTSW 6 49117150 critical splice donor site probably benign
PIT4131001:Igf2bp3 UTSW 6 49117150 critical splice donor site probably null
PIT4142001:Igf2bp3 UTSW 6 49117383 missense probably damaging 0.98
R0207:Igf2bp3 UTSW 6 49105617 missense probably benign 0.03
R0541:Igf2bp3 UTSW 6 49107467 splice site probably benign
R1710:Igf2bp3 UTSW 6 49105631 missense probably damaging 1.00
R1764:Igf2bp3 UTSW 6 49109046 missense probably damaging 1.00
R2156:Igf2bp3 UTSW 6 49108924 critical splice donor site probably null
R2207:Igf2bp3 UTSW 6 49088554 missense possibly damaging 0.92
R5638:Igf2bp3 UTSW 6 49087800 missense probably damaging 1.00
R5899:Igf2bp3 UTSW 6 49117150 critical splice donor site probably benign
R6108:Igf2bp3 UTSW 6 49117374 missense probably damaging 1.00
R6243:Igf2bp3 UTSW 6 49107428 missense possibly damaging 0.61
R6340:Igf2bp3 UTSW 6 49214459 missense probably damaging 1.00
R7380:Igf2bp3 UTSW 6 49108999 missense probably benign 0.27
R7731:Igf2bp3 UTSW 6 49134731 missense probably damaging 0.99
R8004:Igf2bp3 UTSW 6 49091020 missense probably benign
R8727:Igf2bp3 UTSW 6 49109075 splice site probably benign
R8861:Igf2bp3 UTSW 6 49105616 missense possibly damaging 0.93
R8902:Igf2bp3 UTSW 6 49088431 missense probably damaging 0.99
Z1177:Igf2bp3 UTSW 6 49214428 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCATGTGAGACCAACAACGC -3'
(R):5'- TTGCCTACATCCCAGATGAAAC -3'

Sequencing Primer
(F):5'- CATGATCAGGTGACAAGGCTTCC -3'
(R):5'- TCCCAGATGAAACTGCTGC -3'
Posted On 2019-07-10