Mutagenetix > Incidental Mutation

Incidental Mutation 'R6966:Cnot1'

541999

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

045076-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6966 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

96446079-96534092 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 96451160 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 2189 (L2189Q)

Ref Sequence

ENSEMBL: ENSMUSP00000148807 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000068452
AA Change: L2191Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: L2191Q

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000098473
AA Change: L2196Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: L2196Q

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000211887
AA Change: L2189Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000213006

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam26b	G	A	8: 43,974,472 (GRCm39)	R177C	possibly damaging	Het
Adgrb2	CG	C	4: 129,908,155 (GRCm39)		probably null	Het
Bahcc1	G	A	11: 120,173,985 (GRCm39)	V1582M	probably damaging	Het
Baiap2	A	T	11: 119,897,231 (GRCm39)	R529*	probably null	Het
Bcl9l	C	T	9: 44,420,685 (GRCm39)	Q1327*	probably null	Het
Brsk2	T	A	7: 141,538,270 (GRCm39)	C139S	possibly damaging	Het
Catsper3	T	A	13: 55,946,672 (GRCm39)	I123N	probably damaging	Het
Cd84	A	G	1: 171,713,976 (GRCm39)	N325D	possibly damaging	Het
Chid1	T	A	7: 141,076,297 (GRCm39)	Y357F	possibly damaging	Het
Clstn2	A	T	9: 97,408,459 (GRCm39)	Y416*	probably null	Het
Csnk2b	T	A	17: 35,336,758 (GRCm39)	I170L	probably benign	Het
Dnah3	T	C	7: 119,631,977 (GRCm39)	Q1326R	probably damaging	Het
Drd1	T	C	13: 54,207,564 (GRCm39)	I210V	probably damaging	Het
Eef1d	G	T	15: 75,775,558 (GRCm39)	Q34K	probably benign	Het
Fam184a	T	C	10: 53,531,095 (GRCm39)	T760A	probably benign	Het
Fnip1	G	T	11: 54,373,385 (GRCm39)	V199F	probably benign	Het
Glyatl3	T	C	17: 41,215,829 (GRCm39)	K226E	probably damaging	Het
Gm19410	C	T	8: 36,285,127 (GRCm39)	T2093I	possibly damaging	Het
Herc1	A	T	9: 66,318,347 (GRCm39)	E1206D	probably benign	Het
Hs6st1	G	A	1: 36,143,299 (GRCm39)	W411*	probably null	Het
Hsf2	C	A	10: 57,372,080 (GRCm39)	S60R	probably damaging	Het
Hyal5	C	A	6: 24,891,291 (GRCm39)	N368K	probably damaging	Het
Itgb2l	A	T	16: 96,231,843 (GRCm39)	F308I	probably benign	Het
Kdm7a	G	A	6: 39,129,773 (GRCm39)	L468F	probably damaging	Het
Lamp3	A	T	16: 19,518,403 (GRCm39)	L278*	probably null	Het
Ly6c1	A	T	15: 74,917,289 (GRCm39)		probably benign	Het
Mark3	A	G	12: 111,606,458 (GRCm39)	N524D	probably damaging	Het
Met	T	G	6: 17,531,531 (GRCm39)	L603R	possibly damaging	Het
Mical1	A	T	10: 41,355,750 (GRCm39)	Q198L	probably damaging	Het
Nacad	T	A	11: 6,552,634 (GRCm39)	I186F	possibly damaging	Het
Nt5c3b	A	T	11: 100,320,750 (GRCm39)	M257K	probably benign	Het
Nuak2	T	C	1: 132,252,770 (GRCm39)	M108T	possibly damaging	Het
Nub1	T	A	5: 24,894,470 (GRCm39)	Y51N	probably damaging	Het
Nxpe5	T	C	5: 138,237,679 (GRCm39)	S68P	probably damaging	Het
Or10ag58	C	T	2: 87,265,623 (GRCm39)	T264I	probably damaging	Het
Or5d44	A	G	2: 88,141,835 (GRCm39)	S102P	probably benign	Het
Or6c66	A	G	10: 129,461,633 (GRCm39)	V99A	probably benign	Het
Pias3	A	G	3: 96,609,511 (GRCm39)	D276G	probably damaging	Het
Setd7	A	G	3: 51,437,605 (GRCm39)	Y217H	probably damaging	Het
Slc23a1	A	T	18: 35,758,114 (GRCm39)	I142N	probably damaging	Het
Slx4ip	T	C	2: 136,910,144 (GRCm39)	S310P	probably damaging	Het
Tcp11l2	G	A	10: 84,427,133 (GRCm39)	R199Q	possibly damaging	Het
Tgm4	T	A	9: 122,880,207 (GRCm39)	D226E	possibly damaging	Het
Tspyl4	C	A	10: 34,173,673 (GRCm39)	A55E	probably benign	Het
Uap1l1	A	G	2: 25,254,950 (GRCm39)	I146T	probably damaging	Het
Ush2a	G	A	1: 188,308,441 (GRCm39)	G2030D	probably damaging	Het
Uts2r	G	A	11: 121,052,213 (GRCm39)	G359D	possibly damaging	Het
Vwa7	T	C	17: 35,236,072 (GRCm39)	S9P	probably benign	Het
Zbtb16	A	G	9: 48,568,654 (GRCm39)	C604R	probably damaging	Het
Zfp804b	A	G	5: 6,821,615 (GRCm39)	S483P	probably damaging	Het
Zfpm1	G	A	8: 123,058,904 (GRCm39)	A175T	probably damaging	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	96,452,707 (GRCm39)	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	96,487,165 (GRCm39)	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	96,467,637 (GRCm39)	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	96,455,346 (GRCm39)	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	96,482,761 (GRCm39)	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	96,500,113 (GRCm39)	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	96,471,645 (GRCm39)	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	96,481,706 (GRCm39)	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	96,496,243 (GRCm39)	intron	probably benign
IGL03174:Cnot1	APN	8	96,487,983 (GRCm39)	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	96,462,308 (GRCm39)	splice site	probably benign
IGL03371:Cnot1	APN	8	96,501,344 (GRCm39)	missense	possibly damaging	0.85
Affiliate	UTSW	8	96,491,753 (GRCm39)	missense	probably damaging	0.99
Barge	UTSW	8	96,460,757 (GRCm39)	missense	probably benign	0.13
Byproduct	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
Chairman	UTSW	8	96,491,655 (GRCm39)	missense	possibly damaging	0.95
cohort	UTSW	8	96,462,377 (GRCm39)	missense	probably damaging	0.99
Director	UTSW	8	96,491,690 (GRCm39)	missense	probably benign	0.15
kowloon	UTSW	8	96,515,286 (GRCm39)	missense	probably damaging	1.00
Quorum	UTSW	8	96,452,746 (GRCm39)	missense	probably damaging	1.00
tugboat	UTSW	8	96,500,246 (GRCm39)	missense	probably damaging	0.99
Xiao	UTSW	8	96,457,048 (GRCm39)	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
BB003:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
BB011:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
BB013:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R0008:Cnot1	UTSW	8	96,487,969 (GRCm39)	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	96,487,969 (GRCm39)	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	96,489,772 (GRCm39)	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	96,498,628 (GRCm39)	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	96,475,483 (GRCm39)	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	96,486,836 (GRCm39)	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	96,455,295 (GRCm39)	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	96,469,841 (GRCm39)	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	96,496,460 (GRCm39)	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	96,474,904 (GRCm39)	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	96,451,205 (GRCm39)	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	96,469,749 (GRCm39)	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	96,469,749 (GRCm39)	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	96,469,749 (GRCm39)	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	96,468,572 (GRCm39)	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	96,451,221 (GRCm39)	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	96,466,469 (GRCm39)	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	96,466,461 (GRCm39)	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	96,466,461 (GRCm39)	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	96,466,461 (GRCm39)	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	96,501,986 (GRCm39)	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	96,452,781 (GRCm39)	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	96,488,054 (GRCm39)	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	96,496,149 (GRCm39)	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	96,496,149 (GRCm39)	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	96,489,814 (GRCm39)	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	96,489,814 (GRCm39)	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	96,489,814 (GRCm39)	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	96,475,690 (GRCm39)	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	96,501,280 (GRCm39)	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	96,462,377 (GRCm39)	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	96,462,377 (GRCm39)	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	96,500,246 (GRCm39)	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	96,466,476 (GRCm39)	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	96,496,407 (GRCm39)	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	96,501,310 (GRCm39)	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	96,459,859 (GRCm39)	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	96,489,695 (GRCm39)	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	96,448,254 (GRCm39)	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	96,467,636 (GRCm39)	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	96,479,396 (GRCm39)	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	96,486,815 (GRCm39)	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	96,483,983 (GRCm39)	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	96,470,924 (GRCm39)	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	96,460,775 (GRCm39)	nonsense	probably null
R5956:Cnot1	UTSW	8	96,481,606 (GRCm39)	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	96,515,293 (GRCm39)	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	96,475,522 (GRCm39)	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	96,457,048 (GRCm39)	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	96,468,549 (GRCm39)	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	96,499,895 (GRCm39)	intron	probably benign
R6882:Cnot1	UTSW	8	96,447,054 (GRCm39)	missense	possibly damaging	0.85
R6985:Cnot1	UTSW	8	96,460,757 (GRCm39)	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	96,515,286 (GRCm39)	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	96,459,787 (GRCm39)	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	96,454,276 (GRCm39)	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	96,478,447 (GRCm39)	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	96,497,260 (GRCm39)	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	96,486,726 (GRCm39)	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	96,491,753 (GRCm39)	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	96,491,690 (GRCm39)	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	96,478,406 (GRCm39)	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R7914:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R7924:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R7926:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R7981:Cnot1	UTSW	8	96,489,797 (GRCm39)	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	96,479,380 (GRCm39)	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	96,491,655 (GRCm39)	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	96,487,979 (GRCm39)	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	96,478,389 (GRCm39)	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	96,473,649 (GRCm39)	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	96,496,472 (GRCm39)	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	96,460,952 (GRCm39)	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	96,462,907 (GRCm39)	missense	probably benign	0.00
R8934:Cnot1	UTSW	8	96,491,695 (GRCm39)	missense	probably benign	0.04
R9025:Cnot1	UTSW	8	96,475,660 (GRCm39)	missense	probably benign
R9179:Cnot1	UTSW	8	96,500,054 (GRCm39)	missense	probably benign	0.16
R9280:Cnot1	UTSW	8	96,497,227 (GRCm39)	missense	probably benign	0.15
R9285:Cnot1	UTSW	8	96,452,746 (GRCm39)	missense	probably damaging	1.00
R9299:Cnot1	UTSW	8	96,468,448 (GRCm39)	missense	probably damaging	1.00
R9337:Cnot1	UTSW	8	96,468,448 (GRCm39)	missense	probably damaging	1.00
R9480:Cnot1	UTSW	8	96,497,338 (GRCm39)	missense	possibly damaging	0.94
R9548:Cnot1	UTSW	8	96,482,854 (GRCm39)	missense	probably benign	0.02
R9601:Cnot1	UTSW	8	96,482,835 (GRCm39)	missense	probably benign	0.02
R9629:Cnot1	UTSW	8	96,455,874 (GRCm39)	missense	probably damaging	0.98
R9752:Cnot1	UTSW	8	96,488,019 (GRCm39)	missense	probably damaging	1.00
R9764:Cnot1	UTSW	8	96,496,209 (GRCm39)	missense	probably benign	0.00
R9789:Cnot1	UTSW	8	96,455,772 (GRCm39)	missense	probably damaging	1.00
X0050:Cnot1	UTSW	8	96,469,726 (GRCm39)	splice site	probably null
Z1176:Cnot1	UTSW	8	96,474,905 (GRCm39)	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- ACTTAAATCTGGGGATGGATGTC -3'
(R):5'- GAAGGGCTTGTTAACATCTGTG -3'

Sequencing Primer
(F):5'- GGTGGCTCACAACCATCTGTAATG -3'
(R):5'- GCTTGTTAACATCTGTGATTGATTG -3'

Posted On

2018-11-28