Incidental Mutation 'R6979:Prkar2a'
ID542619
Institutional Source Beutler Lab
Gene Symbol Prkar2a
Ensembl Gene ENSMUSG00000032601
Gene Nameprotein kinase, cAMP dependent regulatory, type II alpha
Synonyms1110061A24Rik, RII(alpha)
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6979 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108689314-108750436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108733143 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 190 (N190K)
Ref Sequence ENSEMBL: ENSMUSP00000035220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035220] [ENSMUST00000192344] [ENSMUST00000195405]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035220
AA Change: N190K

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035220
Gene: ENSMUSG00000032601
AA Change: N190K

DomainStartEndE-ValueType
RIIa 8 45 7.15e-16 SMART
low complexity region 70 85 N/A INTRINSIC
low complexity region 104 114 N/A INTRINSIC
cNMP 137 257 2.27e-23 SMART
cNMP 259 384 2.02e-29 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000192344
Predicted Effect probably benign
Transcript: ENSMUST00000195405
AA Change: N190K

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000141869
Gene: ENSMUSG00000032601
AA Change: N190K

DomainStartEndE-ValueType
RIIa 8 45 4.3e-18 SMART
low complexity region 70 85 N/A INTRINSIC
low complexity region 104 114 N/A INTRINSIC
cNMP 137 257 1.1e-25 SMART
cNMP 259 362 3.9e-12 SMART
Meta Mutation Damage Score 0.0816 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. It may interact with various A-kinase anchoring proteins and determine the subcellular localization of cAMP-dependent protein kinase. This subunit has been shown to regulate protein transport from endosomes to the Golgi apparatus and further to the endoplasmic reticulum (ER). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and appear healthy. They have normal growth and no deficits in locomotor activity, muscle strength, or exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac C T 3: 60,040,003 T374M probably benign Het
Aspg A G 12: 112,120,944 D278G possibly damaging Het
Aspm C A 1: 139,480,485 A2370E probably damaging Het
Ccnt2 T C 1: 127,775,136 M65T probably damaging Het
Cd163 A G 6: 124,317,986 T670A probably benign Het
Cpne3 G A 4: 19,533,098 T279I probably benign Het
Ctdspl G A 9: 119,040,530 V227M probably damaging Het
Ctnnd2 A G 15: 30,619,230 E99G probably damaging Het
Dapk1 T C 13: 60,748,281 S728P probably damaging Het
Dmxl2 A G 9: 54,450,879 I512T possibly damaging Het
Dopey1 A T 9: 86,521,642 T1630S possibly damaging Het
Dqx1 A G 6: 83,061,011 D460G probably damaging Het
Foxg1 T C 12: 49,384,784 probably benign Het
H2-Q2 T A 17: 35,345,647 probably null Het
Hes6 T C 1: 91,413,088 E17G possibly damaging Het
Ighv1-42 T C 12: 114,937,228 Y79C possibly damaging Het
Itfg2 T C 6: 128,411,591 D311G probably damaging Het
Itgb5 T A 16: 33,919,986 C489S probably damaging Het
Map4k5 A T 12: 69,822,848 C488S probably damaging Het
Mark1 C T 1: 184,912,628 G377D possibly damaging Het
Mat2a A G 6: 72,435,113 V318A probably damaging Het
Mpp7 T G 18: 7,355,049 N459T possibly damaging Het
Mrc2 C A 11: 105,348,635 N1348K probably damaging Het
Mroh5 T C 15: 73,793,129 K264R probably benign Het
Mtor A G 4: 148,524,473 M1529V possibly damaging Het
Mtrr C T 13: 68,570,003 probably null Het
Nwd1 C T 8: 72,667,660 P517L probably damaging Het
Olfr1100 A G 2: 86,978,233 S188P probably damaging Het
Olfr1197 T A 2: 88,729,184 R138S probably benign Het
Polr1c A G 17: 46,246,169 F63L probably damaging Het
Polrmt C T 10: 79,746,566 probably null Het
Pomt2 T C 12: 87,130,351 I287M probably damaging Het
Prl3d3 T A 13: 27,157,562 Y59N possibly damaging Het
Prl5a1 T A 13: 28,151,206 F199L probably benign Het
Prpf38b A G 3: 108,911,324 V40A probably benign Het
Ptchd1 T A X: 155,574,712 Y499F probably damaging Het
Ptgs1 A G 2: 36,251,299 D586G probably benign Het
Slx4 T C 16: 3,985,015 K1312E probably damaging Het
Smok3c A G 5: 138,064,725 D158G probably benign Het
Spen A T 4: 141,478,063 D1084E unknown Het
Tcp11l1 C T 2: 104,706,439 G27D probably benign Het
Tep1 A G 14: 50,838,637 S1679P possibly damaging Het
Tmem259 C T 10: 79,978,557 V322I possibly damaging Het
Tmpo A T 10: 91,152,497 probably null Het
Ttn C A 2: 76,724,793 A30623S probably damaging Het
Ube2l3 G A 16: 17,159,977 probably benign Het
Unkl A G 17: 25,199,916 D146G probably damaging Het
Vmn1r51 A T 6: 90,129,204 H34L possibly damaging Het
Vmn2r17 A G 5: 109,428,399 T379A possibly damaging Het
Zfp35 G T 18: 24,003,870 G424C probably benign Het
Zfp420 T A 7: 29,876,021 H555Q probably damaging Het
Other mutations in Prkar2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Prkar2a APN 9 108733204 missense possibly damaging 0.92
IGL02073:Prkar2a APN 9 108733123 missense probably damaging 0.99
IGL02117:Prkar2a APN 9 108719261 missense probably damaging 1.00
IGL02268:Prkar2a APN 9 108746953 missense probably benign 0.04
IGL02635:Prkar2a APN 9 108728277 missense probably damaging 0.99
IGL03006:Prkar2a APN 9 108740441 missense probably benign
PIT4486001:Prkar2a UTSW 9 108733127 missense probably damaging 1.00
R0335:Prkar2a UTSW 9 108719258 missense probably damaging 1.00
R0920:Prkar2a UTSW 9 108719297 splice site probably benign
R0943:Prkar2a UTSW 9 108733276 splice site probably benign
R1513:Prkar2a UTSW 9 108728270 missense possibly damaging 0.82
R2178:Prkar2a UTSW 9 108740538 critical splice donor site probably null
R3820:Prkar2a UTSW 9 108746956 missense probably damaging 1.00
R3842:Prkar2a UTSW 9 108728268 missense probably damaging 1.00
R4807:Prkar2a UTSW 9 108740385 intron probably benign
R4886:Prkar2a UTSW 9 108745624 critical splice donor site probably null
R5051:Prkar2a UTSW 9 108745491 missense probably benign 0.00
R5435:Prkar2a UTSW 9 108740483 missense probably damaging 1.00
R7121:Prkar2a UTSW 9 108692622 missense probably benign
R7199:Prkar2a UTSW 9 108740470 missense probably damaging 1.00
R7819:Prkar2a UTSW 9 108745545 missense probably damaging 1.00
R8194:Prkar2a UTSW 9 108692511 missense probably damaging 1.00
R8218:Prkar2a UTSW 9 108719249 missense possibly damaging 0.83
R8253:Prkar2a UTSW 9 108740439 missense probably damaging 1.00
X0060:Prkar2a UTSW 9 108745582 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAAATTATGTTGGTTATCCCCTG -3'
(R):5'- ACATGTGGCTAAGTCATTGAGGAAAC -3'

Sequencing Primer
(F):5'- ACATGAACTGCTATGCCTGG -3'
(R):5'- TAGTGACACGTGACACGA -3'
Posted On2018-11-28