Mutagenetix > Incidental Mutation

Incidental Mutation 'R6979:Mpp7'

542640

Institutional Source

Beutler Lab

Gene Symbol

Mpp7

Ensembl Gene

ENSMUSG00000057440

Gene Name

membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)

Synonyms

2810038M04Rik, LOC381166, 1110068J02Rik, 5430426E14Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.190) question?

Stock #

R6979 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

7347962-7626863 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 7355049 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Threonine at position 459 (N459T)

Ref Sequence

ENSEMBL: ENSMUSP00000111535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115869]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115869
AA Change: N459T

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000111535
Gene: ENSMUSG00000057440
AA Change: N459T

Domain	Start	End	E-Value	Type
L27	10	68	7.05e-14	SMART
L27	72	125	3.72e-13	SMART
PDZ	147	220	3.8e-15	SMART
SH3	231	297	1.4e-11	SMART
low complexity region	317	328	N/A	INTRINSIC
GuKc	367	563	4.01e-65	SMART

Meta Mutation Damage Score

0.2939

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the p55 Stardust family of membrane-associated guanylate kinase (MAGUK) proteins, which function in the establishment of epithelial cell polarity. This family member forms a complex with the polarity protein DLG1 (discs, large homolog 1) and facilitates epithelial cell polarity and tight junction formation. Polymorphisms in this gene are associated with variations in site-specific bone mineral density (BMD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadac	C	T	3: 60,040,003	T374M	probably benign	Het
Aspg	A	G	12: 112,120,944	D278G	possibly damaging	Het
Aspm	C	A	1: 139,480,485	A2370E	probably damaging	Het
Ccnt2	T	C	1: 127,775,136	M65T	probably damaging	Het
Cd163	A	G	6: 124,317,986	T670A	probably benign	Het
Cpne3	G	A	4: 19,533,098	T279I	probably benign	Het
Ctdspl	G	A	9: 119,040,530	V227M	probably damaging	Het
Ctnnd2	A	G	15: 30,619,230	E99G	probably damaging	Het
Dapk1	T	C	13: 60,748,281	S728P	probably damaging	Het
Dmxl2	A	G	9: 54,450,879	I512T	possibly damaging	Het
Dopey1	A	T	9: 86,521,642	T1630S	possibly damaging	Het
Dqx1	A	G	6: 83,061,011	D460G	probably damaging	Het
Foxg1	T	C	12: 49,384,784		probably benign	Het
H2-Q2	T	A	17: 35,345,647		probably null	Het
Hes6	T	C	1: 91,413,088	E17G	possibly damaging	Het
Ighv1-42	T	C	12: 114,937,228	Y79C	possibly damaging	Het
Itfg2	T	C	6: 128,411,591	D311G	probably damaging	Het
Itgb5	T	A	16: 33,919,986	C489S	probably damaging	Het
Map4k5	A	T	12: 69,822,848	C488S	probably damaging	Het
Mark1	C	T	1: 184,912,628	G377D	possibly damaging	Het
Mat2a	A	G	6: 72,435,113	V318A	probably damaging	Het
Mrc2	C	A	11: 105,348,635	N1348K	probably damaging	Het
Mroh5	T	C	15: 73,793,129	K264R	probably benign	Het
Mtor	A	G	4: 148,524,473	M1529V	possibly damaging	Het
Mtrr	C	T	13: 68,570,003		probably null	Het
Nwd1	C	T	8: 72,667,660	P517L	probably damaging	Het
Olfr1100	A	G	2: 86,978,233	S188P	probably damaging	Het
Olfr1197	T	A	2: 88,729,184	R138S	probably benign	Het
Polr1c	A	G	17: 46,246,169	F63L	probably damaging	Het
Polrmt	C	T	10: 79,746,566		probably null	Het
Pomt2	T	C	12: 87,130,351	I287M	probably damaging	Het
Prkar2a	T	A	9: 108,733,143	N190K	possibly damaging	Het
Prl3d3	T	A	13: 27,157,562	Y59N	possibly damaging	Het
Prl5a1	T	A	13: 28,151,206	F199L	probably benign	Het
Prpf38b	A	G	3: 108,911,324	V40A	probably benign	Het
Ptchd1	T	A	X: 155,574,712	Y499F	probably damaging	Het
Ptgs1	A	G	2: 36,251,299	D586G	probably benign	Het
Slx4	T	C	16: 3,985,015	K1312E	probably damaging	Het
Smok3c	A	G	5: 138,064,725	D158G	probably benign	Het
Spen	A	T	4: 141,478,063	D1084E	unknown	Het
Tcp11l1	C	T	2: 104,706,439	G27D	probably benign	Het
Tep1	A	G	14: 50,838,637	S1679P	possibly damaging	Het
Tmem259	C	T	10: 79,978,557	V322I	possibly damaging	Het
Tmpo	A	T	10: 91,152,497		probably null	Het
Ttn	C	A	2: 76,724,793	A30623S	probably damaging	Het
Ube2l3	G	A	16: 17,159,977		probably benign	Het
Unkl	A	G	17: 25,199,916	D146G	probably damaging	Het
Vmn1r51	A	T	6: 90,129,204	H34L	possibly damaging	Het
Vmn2r17	A	G	5: 109,428,399	T379A	possibly damaging	Het
Zfp35	G	T	18: 24,003,870	G424C	probably benign	Het
Zfp420	T	A	7: 29,876,021	H555Q	probably damaging	Het

Other mutations in Mpp7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00938:Mpp7	APN	18	7353297	missense	probably benign	0.00
IGL01575:Mpp7	APN	18	7403365	splice site	probably benign
IGL02973:Mpp7	APN	18	7403297	missense	probably damaging	1.00
IGL02985:Mpp7	APN	18	7461637	critical splice donor site	probably null
IGL03224:Mpp7	APN	18	7403269	missense	probably benign	0.28
IGL03248:Mpp7	APN	18	7403269	missense	probably benign	0.28
R0040:Mpp7	UTSW	18	7403180	splice site	probably benign
R0089:Mpp7	UTSW	18	7439555	splice site	probably benign
R1413:Mpp7	UTSW	18	7350977	missense	probably damaging	1.00
R1634:Mpp7	UTSW	18	7350984	missense	possibly damaging	0.63
R1859:Mpp7	UTSW	18	7350967	makesense	probably null
R2379:Mpp7	UTSW	18	7403345	nonsense	probably null
R2869:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2869:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2871:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2871:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3008:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3009:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3010:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3782:Mpp7	UTSW	18	7351085	missense	probably damaging	0.99
R3980:Mpp7	UTSW	18	7444062	missense	probably benign	0.23
R4574:Mpp7	UTSW	18	7353228	missense	probably benign	0.02
R4772:Mpp7	UTSW	18	7379983	splice site	probably null
R5066:Mpp7	UTSW	18	7513002	missense	possibly damaging	0.95
R5437:Mpp7	UTSW	18	7458930	critical splice donor site	probably null
R5451:Mpp7	UTSW	18	7442855	missense	probably null	0.95
R5578:Mpp7	UTSW	18	7355101	missense	probably benign
R5651:Mpp7	UTSW	18	7355016	critical splice donor site	probably null
R5787:Mpp7	UTSW	18	7461682	missense	probably benign
R6984:Mpp7	UTSW	18	7441623	missense	probably damaging	1.00
R7448:Mpp7	UTSW	18	7351079	missense	probably damaging	0.98
R7517:Mpp7	UTSW	18	7440183	nonsense	probably null
R8278:Mpp7	UTSW	18	7444025	missense	probably benign
R8373:Mpp7	UTSW	18	7444096	missense	probably damaging	1.00
R8676:Mpp7	UTSW	18	7440430	critical splice donor site	probably null
R9206:Mpp7	UTSW	18	7403327	missense	probably benign	0.12
R9208:Mpp7	UTSW	18	7403327	missense	probably benign	0.12
R9439:Mpp7	UTSW	18	7461692	nonsense	probably null
R9790:Mpp7	UTSW	18	7355049	missense	probably benign	0.07
R9791:Mpp7	UTSW	18	7355049	missense	probably benign	0.07
X0028:Mpp7	UTSW	18	7403273	missense	probably benign	0.04
Z1177:Mpp7	UTSW	18	7355062	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCCTGTGAACTTGACTGAAGAAAAC -3'
(R):5'- ATTTGCCGAAGTGCTTGGC -3'

Sequencing Primer
(F):5'- CCAAGAGATACAAACATTGATCTCTG -3'
(R):5'- CACAGCAAAATTTTTACACATTCAGC -3'

Posted On

2018-11-28