Incidental Mutation 'R7015:Rab34'
ID545265
Institutional Source Beutler Lab
Gene Symbol Rab34
Ensembl Gene ENSMUSG00000002059
Gene NameRAB34, member RAS oncogene family
SynonymsRah1, Narr
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7015 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location78188430-78192193 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 78190152 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 63 (V63F)
Ref Sequence ENSEMBL: ENSMUSP00000123033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002128] [ENSMUST00000056241] [ENSMUST00000060539] [ENSMUST00000078099] [ENSMUST00000108317] [ENSMUST00000108322] [ENSMUST00000150941] [ENSMUST00000207728]
Predicted Effect probably damaging
Transcript: ENSMUST00000002128
AA Change: V57F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002128
Gene: ENSMUSG00000002059
AA Change: V57F

DomainStartEndE-ValueType
RAB 54 219 2.96e-49 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000056241
AA Change: V57F

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000059769
Gene: ENSMUSG00000002059
AA Change: V57F

DomainStartEndE-ValueType
Pfam:Arf 43 205 9.5e-13 PFAM
Pfam:Miro 54 166 9.3e-17 PFAM
Pfam:MMR_HSR1 54 204 4.4e-7 PFAM
Pfam:Ras 54 210 4.8e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060539
SMART Domains Protein: ENSMUSP00000050319
Gene: ENSMUSG00000044122

DomainStartEndE-ValueType
low complexity region 42 53 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078099
SMART Domains Protein: ENSMUSP00000086022
Gene: ENSMUSG00000044122

DomainStartEndE-ValueType
coiled coil region 92 121 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108317
SMART Domains Protein: ENSMUSP00000103953
Gene: ENSMUSG00000044122

DomainStartEndE-ValueType
Blast:PA2c 33 99 2e-12 BLAST
SCOP:d1poc__ 55 102 5e-4 SMART
coiled coil region 179 208 N/A INTRINSIC
low complexity region 235 248 N/A INTRINSIC
low complexity region 285 299 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108322
AA Change: V57F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103958
Gene: ENSMUSG00000002059
AA Change: V57F

DomainStartEndE-ValueType
RAB 54 219 2.96e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000150941
AA Change: V63F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123033
Gene: ENSMUSG00000002059
AA Change: V63F

DomainStartEndE-ValueType
RAB 60 225 2.96e-49 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000122848
Gene: ENSMUSG00000002059
AA Change: V8F

DomainStartEndE-ValueType
Pfam:Arf 1 167 4.1e-17 PFAM
Pfam:Roc 6 122 4.5e-32 PFAM
Pfam:MMR_HSR1 6 156 2.3e-8 PFAM
Pfam:Ras 6 168 1.9e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207728
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 93% (55/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the RAB family of proteins, which are small GTPases involved in protein transport. This family member is a Golgi-bound member of the secretory pathway that is involved in the repositioning of lysosomes and the activation of macropinocytosis. Alternative splicing of this gene results in multiple transcript variants. An alternatively spliced transcript variant produces the nine-amino acid residue-repeats (NARR) protein, which is a functionally distinct nucleolar protein resulting from a different reading frame. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik A G 1: 160,075,168 R3G possibly damaging Het
Abcc2 A G 19: 43,798,178 I150V probably benign Het
Adgrb1 T C 15: 74,574,110 L1085P probably damaging Het
Agbl4 A G 4: 110,478,500 N24D probably damaging Het
Aox2 A G 1: 58,282,758 T70A probably benign Het
Aplf G A 6: 87,641,902 A399V probably damaging Het
Asxl3 A G 18: 22,523,921 S1663G probably benign Het
Bcat1 G C 6: 145,039,583 P43R probably damaging Het
Camk1 T C 6: 113,341,926 R9G probably benign Het
Casp8ap2 T C 4: 32,644,278 V1117A probably damaging Het
Cd300ld4 A T 11: 115,022,707 V174E probably benign Het
Cep85l T C 10: 53,349,055 D146G possibly damaging Het
Clip1 T C 5: 123,613,612 probably benign Het
Cog3 C T 14: 75,713,276 V719I possibly damaging Het
Col4a4 G A 1: 82,506,950 P532L unknown Het
Col6a4 C T 9: 106,033,755 probably null Het
Dync1h1 C T 12: 110,666,087 Q4547* probably null Het
Ergic1 G A 17: 26,654,879 probably benign Het
Foxn4 G A 5: 114,256,855 T337M possibly damaging Het
Gemin5 A T 11: 58,156,740 I336N probably damaging Het
Gm21905 A T 5: 67,946,362 probably null Het
Grik2 C A 10: 49,535,436 R202L probably damaging Het
Iglon5 T C 7: 43,476,927 D184G probably benign Het
Il11ra1 A T 4: 41,765,421 Q172L probably benign Het
Me2 G T 18: 73,781,147 probably null Het
Med24 A G 11: 98,718,852 V73A possibly damaging Het
Mmp24 A G 2: 155,792,624 Q88R probably damaging Het
Mroh3 A T 1: 136,183,331 V819E probably damaging Het
Mrps9 A G 1: 42,898,546 K247R probably benign Het
Myo15b G A 11: 115,871,844 R1254H Het
Ncoa5 A G 2: 165,002,081 L134P probably benign Het
Olfr628 T C 7: 103,732,817 V297A probably null Het
Olfr78 C A 7: 102,742,444 L186F probably damaging Het
Olfr984 A T 9: 40,101,455 F12I probably benign Het
Pdcd11 A G 19: 47,098,226 I224V probably benign Het
Ptprh C A 7: 4,552,627 probably null Het
Rack1 T C 11: 48,801,765 I71T probably benign Het
Rai14 G A 15: 10,589,315 R266* probably null Het
Rsph9 A G 17: 46,129,456 V238A probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sel1l3 A T 5: 53,172,574 C480S probably benign Het
Sh3pxd2a C T 19: 47,268,123 A747T probably benign Het
Slc1a3 T C 15: 8,649,568 N181S probably damaging Het
Slit1 T A 19: 41,629,886 K784* probably null Het
Sos2 T A 12: 69,585,235 Q1297L probably benign Het
Srd5a2 T A 17: 74,027,119 T102S probably benign Het
Ss18l2 A T 9: 121,712,608 I64F probably damaging Het
Tas2r120 T C 6: 132,657,165 F70S possibly damaging Het
Tjap1 G A 17: 46,263,774 A5V possibly damaging Het
Tln2 A T 9: 67,362,647 M488K possibly damaging Het
Tnks T G 8: 34,838,547 I42L probably benign Het
Togaram2 A T 17: 71,709,568 Q640L possibly damaging Het
Triobp C A 15: 78,994,060 Q1682K probably damaging Het
Trip11 C T 12: 101,893,683 E311K probably damaging Het
Ugt2b5 A G 5: 87,139,796 Y171H probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Zfp990 G T 4: 145,536,635 D68Y probably damaging Het
Zranb2 A T 3: 157,536,733 probably null Het
Other mutations in Rab34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01552:Rab34 APN 11 78191438 missense probably damaging 1.00
IGL03180:Rab34 APN 11 78190318 missense probably damaging 1.00
R0190:Rab34 UTSW 11 78191406 missense possibly damaging 0.95
R0465:Rab34 UTSW 11 78190511 nonsense probably null
R1201:Rab34 UTSW 11 78190396 splice site probably null
R1907:Rab34 UTSW 11 78191255 missense probably damaging 1.00
R4411:Rab34 UTSW 11 78188766 splice site probably null
R5564:Rab34 UTSW 11 78191632 missense probably damaging 1.00
R5952:Rab34 UTSW 11 78190268 unclassified probably benign
R6261:Rab34 UTSW 11 78191202 splice site probably null
R7127:Rab34 UTSW 11 78191230 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAACATGTGCAGAGCCCTCC -3'
(R):5'- AATCCACTCCGATGGTAGCC -3'

Sequencing Primer
(F):5'- TCACTCCAGAAAAACAGGTCTG -3'
(R):5'- ACTCCGATGGTAGCCTTGTAATTC -3'
Posted On2019-05-13