Incidental Mutation 'R7055:Prkcsh'
ID547857
Institutional Source Beutler Lab
Gene Symbol Prkcsh
Ensembl Gene ENSMUSG00000003402
Gene Nameprotein kinase C substrate 80K-H
Synonyms80K-H
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7055 (G1)
Quality Score217.009
Status Not validated
Chromosome9
Chromosomal Location22002806-22014222 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 22013161 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 522 (*522W)
Ref Sequence ENSEMBL: ENSMUSP00000149936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003493] [ENSMUST00000003501] [ENSMUST00000115331] [ENSMUST00000216344]
Predicted Effect probably null
Transcript: ENSMUST00000003493
AA Change: *522W
SMART Domains Protein: ENSMUSP00000003493
Gene: ENSMUSG00000003402
AA Change: *522W

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
LDLa 32 72 3.01e-2 SMART
internal_repeat_1 91 105 3.48e-7 PROSPERO
low complexity region 177 191 N/A INTRINSIC
Pfam:EF-hand_5 214 236 5.5e-5 PFAM
Pfam:EF-hand_5 239 257 4.4e-4 PFAM
low complexity region 290 341 N/A INTRINSIC
Pfam:PRKCSH_1 366 512 4.3e-23 PFAM
Pfam:PRKCSH 406 464 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000003501
SMART Domains Protein: ENSMUSP00000003501
Gene: ENSMUSG00000003410

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
RRM 40 113 9.99e-24 SMART
RRM 126 201 2.81e-18 SMART
low complexity region 266 283 N/A INTRINSIC
RRM 285 358 1.79e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115331
AA Change: *529W
SMART Domains Protein: ENSMUSP00000110987
Gene: ENSMUSG00000003402
AA Change: *529W

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
LDLa 32 72 3.01e-2 SMART
internal_repeat_1 91 105 1.7e-7 PROSPERO
low complexity region 177 191 N/A INTRINSIC
Pfam:EF-hand_5 215 236 3.2e-5 PFAM
Pfam:EF-hand_5 239 257 1.2e-3 PFAM
low complexity region 290 352 N/A INTRINSIC
Pfam:PRKCSH_1 373 519 4.4e-23 PFAM
Pfam:PRKCSH 413 471 4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213700
Predicted Effect probably null
Transcript: ENSMUST00000216344
AA Change: *522W
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta-subunit of glucosidase II, an N-linked glycan-processing enzyme in the endoplasmic reticulum. The encoded protein is an acidic phosphoprotein known to be a substrate for protein kinase C. Mutations in this gene have been associated with the autosomal dominant polycystic liver disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogenesis. Mice homozygous for a conditional allele activated in the kidneys or ubiquitously develop polycystic kidney and liver phenotypes, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,221 S178P probably damaging Het
2610008E11Rik C T 10: 79,067,847 E212K probably damaging Het
Abcc4 A T 14: 118,594,785 L736* probably null Het
Acmsd A T 1: 127,753,833 M178L probably benign Het
Adpgk T A 9: 59,313,193 M266K possibly damaging Het
Aldh1b1 G A 4: 45,802,909 R149H possibly damaging Het
Aox2 A G 1: 58,299,768 T307A probably benign Het
C1galt1 T C 6: 7,866,585 Y144H probably damaging Het
Cabin1 G C 10: 75,743,283 Q440E probably benign Het
Casq2 A G 3: 102,142,245 S231G probably damaging Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Cdan1 A G 2: 120,727,861 I490T probably damaging Het
Cep170b T A 12: 112,735,715 V314E probably damaging Het
Col4a4 T C 1: 82,519,036 E413G unknown Het
Cyp3a25 A C 5: 145,992,991 F189L probably benign Het
Dido1 T A 2: 180,661,209 H1634L probably benign Het
Dnaja2 A C 8: 85,548,674 V156G probably benign Het
Dpy19l4 T C 4: 11,290,291 probably null Het
Eomes A T 9: 118,480,499 N240I possibly damaging Het
Fads6 A G 11: 115,285,403 F199L probably benign Het
Fbrs T C 7: 127,487,784 probably null Het
Fndc4 T C 5: 31,294,178 E153G probably benign Het
Fv1 TTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTC 4: 147,870,318 probably null Het
Fzr1 T C 10: 81,370,223 Y210C probably damaging Het
Gjc2 T A 11: 59,177,030 M209L unknown Het
Gpr33 A G 12: 52,024,253 M1T probably null Het
Gtf2a1 A T 12: 91,586,749 I28N possibly damaging Het
Igf2r A C 17: 12,704,323 Y1200D probably damaging Het
Ivd C T 2: 118,873,249 T212I probably damaging Het
Jag1 A G 2: 137,115,489 V101A probably benign Het
Kansl3 A T 1: 36,365,620 V83D possibly damaging Het
Krt81 T A 15: 101,461,125 I249F probably benign Het
Krtap21-1 G A 16: 89,403,703 S17L unknown Het
Macf1 A T 4: 123,409,196 H504Q probably benign Het
Map2 A G 1: 66,416,824 T1499A probably damaging Het
Map3k9 T C 12: 81,724,208 T892A probably damaging Het
Mcl1 G A 3: 95,659,799 V178I probably benign Het
Mrs2 T A 13: 25,004,954 M126L probably benign Het
Msantd1 C A 5: 34,917,661 N9K probably benign Het
Myh9 C T 15: 77,775,198 R116H probably damaging Het
Nfib A T 4: 82,330,425 D308E probably benign Het
Nme2 T A 11: 93,955,590 I11F probably damaging Het
Nmnat3 A G 9: 98,410,233 D111G probably benign Het
Olfr1164 T A 2: 88,093,701 L78F probably damaging Het
Papss2 T C 19: 32,664,427 W501R probably damaging Het
Parn A G 16: 13,626,134 I384T possibly damaging Het
Pcdhb18 A G 18: 37,490,811 D398G possibly damaging Het
Pdcl2 T C 5: 76,317,924 N102D probably benign Het
Pdzrn3 C A 6: 101,151,774 E644* probably null Het
Pi4ka T A 16: 17,317,015 probably benign Het
Polg2 A G 11: 106,777,214 F216L probably damaging Het
Prkcz G T 4: 155,289,634 D108E probably benign Het
Pros1 T C 16: 62,928,102 V646A possibly damaging Het
Ptprc A G 1: 138,089,571 I483T probably damaging Het
Rabep2 T C 7: 126,445,313 I527T possibly damaging Het
Rad50 T C 11: 53,688,102 K543R probably benign Het
Samd4b A G 7: 28,404,033 I553T probably benign Het
Sbpl A T 17: 23,953,302 N214K unknown Het
Scgb2b11 C T 7: 32,210,482 E60K possibly damaging Het
Sgk3 G A 1: 9,886,059 E331K probably damaging Het
Snx6 A T 12: 54,784,079 L32Q probably damaging Het
Srgap3 T A 6: 112,746,963 Q512L probably damaging Het
Srsf12 A G 4: 33,226,157 D135G probably damaging Het
Steap4 A G 5: 7,976,858 T274A probably damaging Het
Svep1 A T 4: 58,064,275 V3236D probably benign Het
Svep1 A T 4: 58,120,642 F797Y probably benign Het
Tmem116 T C 5: 121,467,924 L113P probably damaging Het
Tnfrsf1b A G 4: 145,224,887 V161A probably damaging Het
Tnpo1 G T 13: 98,855,479 Q622K possibly damaging Het
Top1mt A G 15: 75,678,674 V28A probably benign Het
Trim25 T C 11: 88,999,924 S146P probably benign Het
Tuba3b A G 6: 145,621,209 D392G possibly damaging Het
Utrn C T 10: 12,747,921 R191Q probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdfy2 T A 14: 62,900,299 S84T probably benign Het
Zfp873 T A 10: 82,059,998 F225I probably damaging Het
Other mutations in Prkcsh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Prkcsh APN 9 22006565 missense possibly damaging 0.95
R0306:Prkcsh UTSW 9 22006526 splice site probably benign
R0376:Prkcsh UTSW 9 22010251 splice site probably benign
R1690:Prkcsh UTSW 9 22010575 missense probably damaging 1.00
R1834:Prkcsh UTSW 9 22008338 missense probably damaging 0.98
R1856:Prkcsh UTSW 9 22004575 missense possibly damaging 0.55
R1980:Prkcsh UTSW 9 22012868 missense probably damaging 0.99
R1981:Prkcsh UTSW 9 22012868 missense probably damaging 0.99
R1982:Prkcsh UTSW 9 22012868 missense probably damaging 0.99
R2184:Prkcsh UTSW 9 22004732 missense probably damaging 1.00
R3625:Prkcsh UTSW 9 22011252 missense probably null 1.00
R4798:Prkcsh UTSW 9 22011738 missense probably damaging 1.00
R5059:Prkcsh UTSW 9 22012750 missense probably damaging 1.00
R5580:Prkcsh UTSW 9 22011255 critical splice donor site probably null
Z1176:Prkcsh UTSW 9 22013055 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGTGAGTGCCTACCCAAG -3'
(R):5'- TCTTAAGAAGCACTTGGGGAG -3'

Sequencing Primer
(F):5'- GGATCCAGGCCTGACAGC -3'
(R):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
Posted On2019-05-13