Incidental Mutation 'R7055:Prkcz'
ID547841
Institutional Source Beutler Lab
Gene Symbol Prkcz
Ensembl Gene ENSMUSG00000029053
Gene Nameprotein kinase C, zeta
SynonymsPkcz, zetaPKC, aPKCzeta
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7055 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location155260129-155361361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 155289634 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 108 (D108E)
Ref Sequence ENSEMBL: ENSMUSP00000099467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030922] [ENSMUST00000103178] [ENSMUST00000123652] [ENSMUST00000131975]
Predicted Effect probably benign
Transcript: ENSMUST00000030922
AA Change: D291E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000030922
Gene: ENSMUSG00000029053
AA Change: D291E

DomainStartEndE-ValueType
PB1 15 98 4.55e-24 SMART
C1 131 180 6.73e-17 SMART
S_TKc 252 518 5.49e-94 SMART
S_TK_X 519 582 2.58e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103178
AA Change: D108E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099467
Gene: ENSMUSG00000029053
AA Change: D108E

DomainStartEndE-ValueType
S_TKc 69 335 5.49e-94 SMART
S_TK_X 336 399 2.58e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123652
Predicted Effect probably benign
Transcript: ENSMUST00000131975
SMART Domains Protein: ENSMUSP00000116042
Gene: ENSMUSG00000029053

DomainStartEndE-ValueType
C1 23 72 6.73e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) zeta is a member of the PKC family of serine/threonine kinases which are involved in a variety of cellular processes such as proliferation, differentiation and secretion. Unlike the classical PKC isoenzymes which are calcium-dependent, PKC zeta exhibits a kinase activity which is independent of calcium and diacylglycerol but not of phosphatidylserine. Furthermore, it is insensitive to typical PKC inhibitors and cannot be activated by phorbol ester. Unlike the classical PKC isoenzymes, it has only a single zinc finger module. These structural and biochemical properties indicate that the zeta subspecies is related to, but distinct from other isoenzymes of PKC. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Young, not mature, homozygous null mice have reduced B cell numbers and abnormal secondary lymph organ structure. Young mice have fewer Peyer's patches, poor delineation of B & T cell zones, and fewer follicles of small size. Spleens have less prominent B cell follicles and abnormal marginal zones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,221 S178P probably damaging Het
2610008E11Rik C T 10: 79,067,847 E212K probably damaging Het
Abcc4 A T 14: 118,594,785 L736* probably null Het
Acmsd A T 1: 127,753,833 M178L probably benign Het
Adpgk T A 9: 59,313,193 M266K possibly damaging Het
Aldh1b1 G A 4: 45,802,909 R149H possibly damaging Het
Aox2 A G 1: 58,299,768 T307A probably benign Het
C1galt1 T C 6: 7,866,585 Y144H probably damaging Het
Cabin1 G C 10: 75,743,283 Q440E probably benign Het
Casq2 A G 3: 102,142,245 S231G probably damaging Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Cdan1 A G 2: 120,727,861 I490T probably damaging Het
Cep170b T A 12: 112,735,715 V314E probably damaging Het
Col4a4 T C 1: 82,519,036 E413G unknown Het
Cyp3a25 A C 5: 145,992,991 F189L probably benign Het
Dido1 T A 2: 180,661,209 H1634L probably benign Het
Dnaja2 A C 8: 85,548,674 V156G probably benign Het
Dpy19l4 T C 4: 11,290,291 probably null Het
Eomes A T 9: 118,480,499 N240I possibly damaging Het
Fads6 A G 11: 115,285,403 F199L probably benign Het
Fbrs T C 7: 127,487,784 probably null Het
Fndc4 T C 5: 31,294,178 E153G probably benign Het
Fv1 TTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTC 4: 147,870,318 probably null Het
Fzr1 T C 10: 81,370,223 Y210C probably damaging Het
Gjc2 T A 11: 59,177,030 M209L unknown Het
Gpr33 A G 12: 52,024,253 M1T probably null Het
Gtf2a1 A T 12: 91,586,749 I28N possibly damaging Het
Igf2r A C 17: 12,704,323 Y1200D probably damaging Het
Ivd C T 2: 118,873,249 T212I probably damaging Het
Jag1 A G 2: 137,115,489 V101A probably benign Het
Kansl3 A T 1: 36,365,620 V83D possibly damaging Het
Krt81 T A 15: 101,461,125 I249F probably benign Het
Krtap21-1 G A 16: 89,403,703 S17L unknown Het
Macf1 A T 4: 123,409,196 H504Q probably benign Het
Map2 A G 1: 66,416,824 T1499A probably damaging Het
Map3k9 T C 12: 81,724,208 T892A probably damaging Het
Mcl1 G A 3: 95,659,799 V178I probably benign Het
Mrs2 T A 13: 25,004,954 M126L probably benign Het
Msantd1 C A 5: 34,917,661 N9K probably benign Het
Myh9 C T 15: 77,775,198 R116H probably damaging Het
Nfib A T 4: 82,330,425 D308E probably benign Het
Nme2 T A 11: 93,955,590 I11F probably damaging Het
Nmnat3 A G 9: 98,410,233 D111G probably benign Het
Olfr1164 T A 2: 88,093,701 L78F probably damaging Het
Papss2 T C 19: 32,664,427 W501R probably damaging Het
Parn A G 16: 13,626,134 I384T possibly damaging Het
Pcdhb18 A G 18: 37,490,811 D398G possibly damaging Het
Pdcl2 T C 5: 76,317,924 N102D probably benign Het
Pdzrn3 C A 6: 101,151,774 E644* probably null Het
Pi4ka T A 16: 17,317,015 probably benign Het
Polg2 A G 11: 106,777,214 F216L probably damaging Het
Prkcsh A G 9: 22,013,161 *522W probably null Het
Pros1 T C 16: 62,928,102 V646A possibly damaging Het
Ptprc A G 1: 138,089,571 I483T probably damaging Het
Rabep2 T C 7: 126,445,313 I527T possibly damaging Het
Rad50 T C 11: 53,688,102 K543R probably benign Het
Samd4b A G 7: 28,404,033 I553T probably benign Het
Sbpl A T 17: 23,953,302 N214K unknown Het
Scgb2b11 C T 7: 32,210,482 E60K possibly damaging Het
Sgk3 G A 1: 9,886,059 E331K probably damaging Het
Snx6 A T 12: 54,784,079 L32Q probably damaging Het
Srgap3 T A 6: 112,746,963 Q512L probably damaging Het
Srsf12 A G 4: 33,226,157 D135G probably damaging Het
Steap4 A G 5: 7,976,858 T274A probably damaging Het
Svep1 A T 4: 58,064,275 V3236D probably benign Het
Svep1 A T 4: 58,120,642 F797Y probably benign Het
Tmem116 T C 5: 121,467,924 L113P probably damaging Het
Tnfrsf1b A G 4: 145,224,887 V161A probably damaging Het
Tnpo1 G T 13: 98,855,479 Q622K possibly damaging Het
Top1mt A G 15: 75,678,674 V28A probably benign Het
Trim25 T C 11: 88,999,924 S146P probably benign Het
Tuba3b A G 6: 145,621,209 D392G possibly damaging Het
Utrn C T 10: 12,747,921 R191Q probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdfy2 T A 14: 62,900,299 S84T probably benign Het
Zfp873 T A 10: 82,059,998 F225I probably damaging Het
Other mutations in Prkcz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Prkcz APN 4 155294401 splice site probably benign
IGL02114:Prkcz APN 4 155271590 missense probably damaging 1.00
IGL02582:Prkcz APN 4 155271256 missense probably damaging 1.00
IGL03010:Prkcz APN 4 155286805 missense probably damaging 1.00
IGL03199:Prkcz APN 4 155272984 missense possibly damaging 0.85
IGL03225:Prkcz APN 4 155268195 missense probably damaging 0.99
IGL03229:Prkcz APN 4 155262506 missense probably benign 0.19
IGL03299:Prkcz APN 4 155286790 missense possibly damaging 0.78
PIT4403001:Prkcz UTSW 4 155293156 critical splice donor site probably null
R0389:Prkcz UTSW 4 155269140 missense probably damaging 1.00
R0443:Prkcz UTSW 4 155269140 missense probably damaging 1.00
R1666:Prkcz UTSW 4 155289751 missense probably damaging 1.00
R1668:Prkcz UTSW 4 155289751 missense probably damaging 1.00
R1686:Prkcz UTSW 4 155271256 missense probably damaging 1.00
R1710:Prkcz UTSW 4 155262512 missense probably damaging 1.00
R2025:Prkcz UTSW 4 155289710 missense probably damaging 1.00
R3162:Prkcz UTSW 4 155290524 missense probably benign 0.00
R3162:Prkcz UTSW 4 155290524 missense probably benign 0.00
R4399:Prkcz UTSW 4 155269077 missense possibly damaging 0.86
R4780:Prkcz UTSW 4 155289702 missense probably damaging 1.00
R4923:Prkcz UTSW 4 155357489 missense probably damaging 1.00
R5160:Prkcz UTSW 4 155293232 missense probably benign 0.22
R5510:Prkcz UTSW 4 155272936 splice site probably null
R6278:Prkcz UTSW 4 155268195 missense probably damaging 0.99
R6290:Prkcz UTSW 4 155356499 missense probably damaging 1.00
R6881:Prkcz UTSW 4 155269056 missense possibly damaging 0.90
R7108:Prkcz UTSW 4 155286793 nonsense probably null
R7241:Prkcz UTSW 4 155269059 missense probably benign 0.00
R7355:Prkcz UTSW 4 155357496 missense probably damaging 1.00
R7466:Prkcz UTSW 4 155271602 missense probably damaging 1.00
R7522:Prkcz UTSW 4 155271285 missense probably damaging 1.00
R7618:Prkcz UTSW 4 155262482 missense probably damaging 1.00
R7753:Prkcz UTSW 4 155272968 missense possibly damaging 0.61
X0067:Prkcz UTSW 4 155354704 missense probably benign 0.25
Z1176:Prkcz UTSW 4 155354680 missense probably damaging 1.00
Z1176:Prkcz UTSW 4 155356468 missense probably damaging 1.00
Z1177:Prkcz UTSW 4 155301004 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGGTGGCATCGTTAAACTC -3'
(R):5'- ACCTCTCCCTAGGACCTTAAG -3'

Sequencing Primer
(F):5'- GGCATCGTTAAACTCAAGGGTTC -3'
(R):5'- AGGACCTTAAGCCTGTCATCGATG -3'
Posted On2019-05-13