Incidental Mutation 'R7059:Myl3'
ID548131
Institutional Source Beutler Lab
Gene Symbol Myl3
Ensembl Gene ENSMUSG00000059741
Gene Namemyosin, light polypeptide 3
SynonymsMLC1v, alkali, slow skeletal, MLC1s, Mylc, ventricular
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock #R7059 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location110741861-110769798 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 110742037 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006005] [ENSMUST00000166716] [ENSMUST00000196057] [ENSMUST00000198865] [ENSMUST00000199791] [ENSMUST00000199862] [ENSMUST00000200011]
Predicted Effect probably benign
Transcript: ENSMUST00000006005
SMART Domains Protein: ENSMUSP00000006005
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 3.5e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166716
SMART Domains Protein: ENSMUSP00000132064
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 9.2e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196057
SMART Domains Protein: ENSMUSP00000143470
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
HormR 104 179 7.8e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198865
SMART Domains Protein: ENSMUSP00000143298
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 3.5e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199791
SMART Domains Protein: ENSMUSP00000142957
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199862
SMART Domains Protein: ENSMUSP00000142672
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 98 173 7.8e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200011
SMART Domains Protein: ENSMUSP00000142530
Gene: ENSMUSG00000059741

DomainStartEndE-ValueType
low complexity region 2 45 N/A INTRINSIC
Pfam:EF-hand_6 62 93 4.7e-3 PFAM
internal_repeat_1 140 182 5.24e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MYL3 encodes myosin light chain 3, an alkali light chain also referred to in the literature as both the ventricular isoform and the slow skeletal muscle isoform. Mutations in MYL3 have been identified as a cause of mid-left ventricular chamber type hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik T C 2: 32,574,497 probably benign Het
9930021J03Rik T A 19: 29,719,545 E849D probably benign Het
Abca16 A G 7: 120,421,748 T5A probably benign Het
Abraxas1 T C 5: 100,806,237 D349G probably benign Het
Adcyap1r1 T A 6: 55,491,310 L405Q probably damaging Het
Aqp5 A T 15: 99,594,246 T125S probably benign Het
Asah1 A T 8: 41,347,069 N169K probably damaging Het
Atl3 A G 19: 7,533,968 N515D probably benign Het
Atl3 A C 19: 7,533,969 N520T probably benign Het
Atp6v1c2 C A 12: 17,289,004 E249* probably null Het
Bcl2a1b T A 9: 89,199,760 I134K probably damaging Het
Btbd10 C T 7: 113,329,922 R159H probably damaging Het
Chmp6 T C 11: 119,916,040 F7L probably damaging Het
Colq C A 14: 31,526,034 C409F probably damaging Het
Cpox T A 16: 58,670,927 V167E probably damaging Het
Cul3 T C 1: 80,276,424 Y545C probably benign Het
Dqx1 C T 6: 83,064,809 A544V probably benign Het
Dzip3 A G 16: 48,980,942 I73T probably benign Het
Epha3 T A 16: 63,568,455 Y810F probably damaging Het
Esp36 A T 17: 38,417,051 I113N unknown Het
Fbxw17 T A 13: 50,432,548 W429R probably damaging Het
Fcrls A T 3: 87,257,340 I293N possibly damaging Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Gm8126 T A 14: 43,261,518 L148H probably benign Het
Gpr39 C A 1: 125,677,959 S208Y probably damaging Het
Heatr5a T C 12: 51,888,234 E1662G probably damaging Het
Hgfac T A 5: 35,044,429 L302Q possibly damaging Het
Itih1 G A 14: 30,931,309 H721Y possibly damaging Het
Kat8 A G 7: 127,924,903 I372V probably benign Het
Kcnk1 T A 8: 126,029,727 Y329* probably null Het
Kcns2 A T 15: 34,838,835 I115F probably damaging Het
Kif1a C T 1: 93,046,829 probably benign Het
Lcn2 T A 2: 32,387,596 D127V possibly damaging Het
Lrfn1 T C 7: 28,466,930 V583A possibly damaging Het
Map3k1 T C 13: 111,772,778 I55V probably benign Het
Mapk9 T C 11: 49,867,047 probably null Het
Mrpl18 A G 17: 12,913,781 S154P possibly damaging Het
Mst1 C A 9: 108,084,064 H524Q probably benign Het
Mtpap T C 18: 4,396,202 L498P probably damaging Het
Myrfl T C 10: 116,849,206 T90A probably benign Het
Mzf1 G T 7: 13,053,058 S28R probably damaging Het
Olfm1 T C 2: 28,222,616 S205P probably damaging Het
Olfr671 A T 7: 104,976,017 probably null Het
Prrc2a G A 17: 35,157,388 P809S probably damaging Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rbm48 A T 5: 3,590,625 C251* probably null Het
Rxfp1 A T 3: 79,652,269 V415E probably damaging Het
Slc12a6 T A 2: 112,352,912 L748Q probably damaging Het
Slc19a3 T A 1: 83,022,369 Y309F probably damaging Het
Slc36a1 A G 11: 55,223,672 D192G probably damaging Het
Slc38a4 G T 15: 97,009,014 S281* probably null Het
Syne1 A T 10: 5,346,859 S1201T probably damaging Het
Tex15 C A 8: 33,574,730 T1396K possibly damaging Het
Zswim8 G T 14: 20,714,573 probably null Het
Other mutations in Myl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Myl3 APN 9 110766489 missense possibly damaging 0.95
IGL01292:Myl3 APN 9 110767977 missense probably damaging 1.00
IGL02814:Myl3 APN 9 110767991 nonsense probably null
R0009:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0010:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0015:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0040:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0045:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0045:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0080:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0081:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0095:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0194:Myl3 UTSW 9 110769121 missense probably benign 0.00
R1938:Myl3 UTSW 9 110766734 missense probably damaging 1.00
R2230:Myl3 UTSW 9 110767911 missense probably damaging 1.00
R2231:Myl3 UTSW 9 110767911 missense probably damaging 1.00
R2315:Myl3 UTSW 9 110766741 missense probably damaging 1.00
R3884:Myl3 UTSW 9 110767959 missense probably damaging 1.00
R5473:Myl3 UTSW 9 110767958 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCGCAGTGTGTGATACTC -3'
(R):5'- AGTGCTCAGCTCCGCATATG -3'

Sequencing Primer
(F):5'- TGTGATACTCCACACCCAGAAC -3'
(R):5'- GCATATGCGCTGGTAAGTCTCTC -3'
Posted On2019-05-13