Mutagenetix > Incidental Mutations

Incidental Mutation 'R7059:Itih1'

548141

Institutional Source

Beutler Lab

Gene Symbol

Itih1

Ensembl Gene

ENSMUSG00000006529

Gene Name

inter-alpha trypsin inhibitor, heavy chain 1

Synonyms

inter-alpha (globulin) inhibitor, H1 polypeptide, Itih-1, Intin1

MMRRC Submission

Accession Numbers

Genbank: NM_008406.3; Ensembl: ENSMUST00000163118

Is this an essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R7059 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30929180-30943289 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 30931309 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 721 (H721Y)

Ref Sequence

ENSEMBL: ENSMUSP00000126449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006704] [ENSMUST00000163118]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006704
AA Change: H725Y

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000006704
Gene: ENSMUSG00000006529
AA Change: H725Y

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
VIT	34	167	6e-79	SMART
low complexity region	240	251	N/A	INTRINSIC
VWA	291	472	2.1e-32	SMART
Blast:VWA	528	577	5e-21	BLAST
Pfam:ITI_HC_C	706	892	2.1e-65	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163118
AA Change: H721Y

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000126449
Gene: ENSMUSG00000006529
AA Change: H721Y

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
VIT	34	163	2.44e-80	SMART
low complexity region	236	247	N/A	INTRINSIC
VWA	287	468	3.43e-30	SMART
Blast:VWA	524	573	5e-21	BLAST
Pfam:ITI_HC_C	701	888	5.3e-81	PFAM

Meta Mutation Damage Score

0.1497

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: This gene encodes a heavy chain of inter-alpha trypsin inhibitor (IaI) family of plasma serine protease inhibitors. IaI proteins are protein-glycosaminoglycan-protein complexes comprised of two heavy chains and a light chain. The encoded protein covalently associates with the light chain via a chondroitin sulfate moiety. Intravenous administration of the encoded protein improved survival of mice after infection with Escherichia coli. This gene is located adjacent to two other IaI heavy chain genes. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing to generate mature protein. [provided by RefSeq, Oct 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430097D07Rik	T	C	2: 32,574,497		probably benign	Het
9930021J03Rik	T	A	19: 29,719,545	E849D	probably benign	Het
Abca16	A	G	7: 120,421,748	T5A	probably benign	Het
Abraxas1	T	C	5: 100,806,237	D349G	probably benign	Het
Adcyap1r1	T	A	6: 55,491,310	L405Q	probably damaging	Het
Aqp5	A	T	15: 99,594,246	T125S	probably benign	Het
Asah1	A	T	8: 41,347,069	N169K	probably damaging	Het
Atl3	A	G	19: 7,533,968	N515D	probably benign	Het
Atl3	A	C	19: 7,533,969	N520T	probably benign	Het
Atp6v1c2	C	A	12: 17,289,004	E249*	probably null	Het
Bcl2a1b	T	A	9: 89,199,760	I134K	probably damaging	Het
Btbd10	C	T	7: 113,329,922	R159H	probably damaging	Het
Chmp6	T	C	11: 119,916,040	F7L	probably damaging	Het
Colq	C	A	14: 31,526,034	C409F	probably damaging	Het
Cpox	T	A	16: 58,670,927	V167E	probably damaging	Het
Cul3	T	C	1: 80,276,424	Y545C	probably benign	Het
Dqx1	C	T	6: 83,064,809	A544V	probably benign	Het
Dzip3	A	G	16: 48,980,942	I73T	probably benign	Het
Epha3	T	A	16: 63,568,455	Y810F	probably damaging	Het
Esp36	A	T	17: 38,417,051	I113N	unknown	Het
Fbxw17	T	A	13: 50,432,548	W429R	probably damaging	Het
Fcrls	A	T	3: 87,257,340	I293N	possibly damaging	Het
Fhad1	CGG	CG	4: 141,918,291		probably null	Het
Gm8126	T	A	14: 43,261,518	L148H	probably benign	Het
Gpr39	C	A	1: 125,677,959	S208Y	probably damaging	Het
Heatr5a	T	C	12: 51,888,234	E1662G	probably damaging	Het
Hgfac	T	A	5: 35,044,429	L302Q	possibly damaging	Het
Kat8	A	G	7: 127,924,903	I372V	probably benign	Het
Kcnk1	T	A	8: 126,029,727	Y329*	probably null	Het
Kcns2	A	T	15: 34,838,835	I115F	probably damaging	Het
Kif1a	C	T	1: 93,046,829		probably benign	Het
Lcn2	T	A	2: 32,387,596	D127V	possibly damaging	Het
Lrfn1	T	C	7: 28,466,930	V583A	possibly damaging	Het
Map3k1	T	C	13: 111,772,778	I55V	probably benign	Het
Mapk9	T	C	11: 49,867,047		probably null	Het
Mrpl18	A	G	17: 12,913,781	S154P	possibly damaging	Het
Mst1	C	A	9: 108,084,064	H524Q	probably benign	Het
Mtpap	T	C	18: 4,396,202	L498P	probably damaging	Het
Myl3	C	T	9: 110,742,037		probably benign	Het
Myrfl	T	C	10: 116,849,206	T90A	probably benign	Het
Mzf1	G	T	7: 13,053,058	S28R	probably damaging	Het
Olfm1	T	C	2: 28,222,616	S205P	probably damaging	Het
Olfr671	A	T	7: 104,976,017		probably null	Het
Prrc2a	G	A	17: 35,157,388	P809S	probably damaging	Het
Rab5c	G	A	11: 100,719,963	R40C	probably damaging	Het
Rbm48	A	T	5: 3,590,625	C251*	probably null	Het
Rxfp1	A	T	3: 79,652,269	V415E	probably damaging	Het
Slc12a6	T	A	2: 112,352,912	L748Q	probably damaging	Het
Slc19a3	T	A	1: 83,022,369	Y309F	probably damaging	Het
Slc36a1	A	G	11: 55,223,672	D192G	probably damaging	Het
Slc38a4	G	T	15: 97,009,014	S281*	probably null	Het
Syne1	A	T	10: 5,346,859	S1201T	probably damaging	Het
Tex15	C	A	8: 33,574,730	T1396K	possibly damaging	Het
Zswim8	G	T	14: 20,714,573		probably null	Het

Other mutations in Itih1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Itih1	APN	14	30929821	missense	probably benign	0.26
IGL00227:Itih1	APN	14	30942889	splice site	probably null
IGL00902:Itih1	APN	14	30932482	splice site	probably benign
IGL02194:Itih1	APN	14	30930365	missense	probably benign	0.01
IGL02221:Itih1	APN	14	30929587	missense	probably damaging	1.00
IGL02292:Itih1	APN	14	30933355	splice site	probably null
IGL02733:Itih1	APN	14	30936720	missense	probably damaging	1.00
IGL02928:Itih1	APN	14	30937758	missense	probably damaging	1.00
IGL03064:Itih1	APN	14	30941557	missense	probably benign	0.09
1mM(1):Itih1	UTSW	14	30929850	missense	probably damaging	1.00
R0092:Itih1	UTSW	14	30940863	splice site	probably benign
R0647:Itih1	UTSW	14	30935863	missense	probably damaging	1.00
R0662:Itih1	UTSW	14	30933360	missense	possibly damaging	0.63
R0744:Itih1	UTSW	14	30941555	missense	probably damaging	1.00
R0833:Itih1	UTSW	14	30941555	missense	probably damaging	1.00
R1070:Itih1	UTSW	14	30942456	splice site	probably benign
R1397:Itih1	UTSW	14	30929905	splice site	probably benign
R1797:Itih1	UTSW	14	30929899	missense	probably damaging	1.00
R1898:Itih1	UTSW	14	30932287	missense	probably benign
R1964:Itih1	UTSW	14	30929623	missense	probably damaging	1.00
R1967:Itih1	UTSW	14	30941984	missense	possibly damaging	0.67
R2086:Itih1	UTSW	14	30937843	missense	probably damaging	1.00
R2155:Itih1	UTSW	14	30938071	missense	probably damaging	1.00
R2156:Itih1	UTSW	14	30933475	missense	possibly damaging	0.88
R2225:Itih1	UTSW	14	30929577	missense	possibly damaging	0.88
R3836:Itih1	UTSW	14	30935828	missense	probably damaging	1.00
R3837:Itih1	UTSW	14	30935828	missense	probably damaging	1.00
R3839:Itih1	UTSW	14	30935828	missense	probably damaging	1.00
R4388:Itih1	UTSW	14	30941555	missense	possibly damaging	0.93
R4504:Itih1	UTSW	14	30935885	missense	probably damaging	1.00
R4618:Itih1	UTSW	14	30929831	missense	probably benign	0.33
R4682:Itih1	UTSW	14	30937843	missense	probably damaging	1.00
R4856:Itih1	UTSW	14	30936701	critical splice donor site	probably null
R4886:Itih1	UTSW	14	30936701	critical splice donor site	probably null
R5169:Itih1	UTSW	14	30933446	nonsense	probably null
R5773:Itih1	UTSW	14	30935399	missense	possibly damaging	0.89
R5875:Itih1	UTSW	14	30929530	missense	probably benign
R6048:Itih1	UTSW	14	30929823	missense	possibly damaging	0.89
R6077:Itih1	UTSW	14	30929876	missense	possibly damaging	0.75
R6175:Itih1	UTSW	14	30931195	missense	probably damaging	1.00
R6228:Itih1	UTSW	14	30931260	missense	probably benign	0.00
R6664:Itih1	UTSW	14	30933436	missense	probably damaging	1.00
R6675:Itih1	UTSW	14	30929841	missense	possibly damaging	0.50
R7168:Itih1	UTSW	14	30934107	missense	probably null	0.98
R7408:Itih1	UTSW	14	30943160	missense	probably benign	0.00
R7458:Itih1	UTSW	14	30943266	start codon destroyed	probably null
R7717:Itih1	UTSW	14	30931185	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTTGACCCATGTCGCAGTG -3'
(R):5'- TCAGGAGTCCAGAGCTCAGAAG -3'

Sequencing Primer
(F):5'- CCATGTCGCAGTGGGTTTCC -3'
(R):5'- CACAGGTGGTCTTGGGAGC -3'

Posted On

2019-05-13