Incidental Mutation 'R7071:Astl'
ID548893
Institutional Source Beutler Lab
Gene Symbol Astl
Ensembl Gene ENSMUSG00000050468
Gene Nameastacin-like metalloendopeptidase (M12 family)
SynonymsSas1b, C87576, Ovastacin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R7071 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location127338639-127357651 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127345965 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 121 (M121T)
Ref Sequence ENSEMBL: ENSMUSP00000087102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059839] [ENSMUST00000089673] [ENSMUST00000156747] [ENSMUST00000179618]
Predicted Effect probably benign
Transcript: ENSMUST00000059839
AA Change: M100T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000054456
Gene: ENSMUSG00000050468
AA Change: M100T

DomainStartEndE-ValueType
Blast:ZnMc 31 60 4e-8 BLAST
ZnMc 69 213 1.13e-39 SMART
low complexity region 292 308 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089673
AA Change: M121T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000087102
Gene: ENSMUSG00000050468
AA Change: M121T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Blast:ZnMc 52 81 5e-8 BLAST
ZnMc 90 234 1.13e-39 SMART
low complexity region 313 329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156747
AA Change: M100T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000116771
Gene: ENSMUSG00000050468
AA Change: M100T

DomainStartEndE-ValueType
Blast:ZnMc 31 60 6e-9 BLAST
ZnMc 69 193 4.02e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179618
AA Change: M100T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000135987
Gene: ENSMUSG00000050468
AA Change: M100T

DomainStartEndE-ValueType
Blast:ZnMc 31 60 4e-8 BLAST
ZnMc 69 213 1.13e-39 SMART
low complexity region 292 308 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 95% (41/43)
MGI Phenotype PHENOTYPE: Mice homozygous for knock-out alleles exhibit reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,629,140 Q854* probably null Het
Arl2bp G T 8: 94,667,166 probably benign Het
Atrip T C 9: 109,067,014 probably null Het
Camk1g A T 1: 193,359,809 V44E probably benign Het
Cc2d2a A G 5: 43,709,113 H804R probably benign Het
Cd300a T C 11: 114,901,273 S314P probably damaging Het
Ceacam5 A T 7: 17,750,652 I440L possibly damaging Het
Cfap61 T G 2: 146,001,912 I306R probably benign Het
Cnot10 T C 9: 114,617,719 probably null Het
Cntln T A 4: 85,100,385 L76Q probably damaging Het
Cobl A G 11: 12,254,795 C636R probably benign Het
Dnm3 A T 1: 162,019,843 H148Q probably damaging Het
Dot1l T A 10: 80,792,245 L1039Q probably benign Het
Faiml T A 9: 99,236,347 M1L unknown Het
Fat1 T G 8: 44,989,108 I1149S possibly damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm11938 A T 11: 99,603,084 C62S probably damaging Het
Gm15448 A G 7: 3,821,668 S573P unknown Het
Gtf2i A G 5: 134,263,621 L423S probably damaging Het
Hmcn1 A T 1: 150,604,102 C4582S probably damaging Het
Ifitm3 A G 7: 141,010,524 V41A probably benign Het
Ipo11 T A 13: 106,925,096 S19C probably damaging Het
Khsrp C A 17: 57,025,386 M268I possibly damaging Het
Lrp1b T G 2: 41,408,264 D1036A Het
Mecom T G 3: 29,980,708 H273P probably damaging Het
Mfn1 G A 3: 32,568,395 V601I probably benign Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Myo18a A G 11: 77,823,827 T811A probably damaging Het
Ndfip2 A C 14: 105,302,326 N292H possibly damaging Het
Olfr318 C A 11: 58,720,158 V297F possibly damaging Het
Otog T A 7: 46,267,323 C895S probably damaging Het
Pacs1 A T 19: 5,156,374 I261N possibly damaging Het
Ptprn A T 1: 75,260,619 M113K possibly damaging Het
Rag1 T C 2: 101,643,462 H445R probably damaging Het
Ranbp2 T G 10: 58,492,837 F2853V probably damaging Het
Skint5 A T 4: 113,779,080 F647Y unknown Het
Stt3b T C 9: 115,254,017 Y449C probably damaging Het
Ythdc2 A G 18: 44,845,788 D455G probably benign Het
Zfp451 A C 1: 33,776,744 D708E possibly damaging Het
Zfp456 T C 13: 67,372,777 E33G probably damaging Het
Zfp599 T C 9: 22,258,096 T27A probably benign Het
Other mutations in Astl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Astl APN 2 127344021 splice site probably null
IGL01952:Astl APN 2 127342478 critical splice donor site probably null
R0833:Astl UTSW 2 127342419 missense probably benign
R0836:Astl UTSW 2 127342419 missense probably benign
R1351:Astl UTSW 2 127347185 missense possibly damaging 0.95
R1672:Astl UTSW 2 127347243 missense probably damaging 1.00
R1809:Astl UTSW 2 127345485 missense probably damaging 1.00
R2145:Astl UTSW 2 127347189 missense probably damaging 1.00
R5669:Astl UTSW 2 127347279 missense probably damaging 1.00
R6057:Astl UTSW 2 127345969 missense probably benign
R6912:Astl UTSW 2 127356386 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GTCTTTTCTGCAGCTCAGGC -3'
(R):5'- AGGCCCAGAAATAAGCTTGG -3'

Sequencing Primer
(F):5'- AGCTCAGGCATCCTCTTCAG -3'
(R):5'- GCCCAGAAATAAGCTTGGATTTGTG -3'
Posted On2019-05-15