Incidental Mutation 'R7071:Ndfip2'
ID548921
Institutional Source Beutler Lab
Gene Symbol Ndfip2
Ensembl Gene ENSMUSG00000053253
Gene NameNedd4 family interacting protein 2
Synonyms0710001O20Rik, 9130207N19Rik, N4wbp5a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7071 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location105258573-105309298 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 105302326 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 292 (N292H)
Ref Sequence ENSEMBL: ENSMUSP00000137875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000181969]
Predicted Effect
SMART Domains Protein: ENSMUSP00000121854
Gene: ENSMUSG00000053253
AA Change: N265H

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 29 58 N/A INTRINSIC
low complexity region 103 129 N/A INTRINSIC
Pfam:DUF2370 150 266 1.4e-10 PFAM
transmembrane domain 269 291 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000181969
AA Change: N292H

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137875
Gene: ENSMUSG00000053253
AA Change: N292H

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
low complexity region 55 84 N/A INTRINSIC
low complexity region 129 155 N/A INTRINSIC
Pfam:DUF2370 171 290 2.1e-37 PFAM
Pfam:DUF2370 285 333 2.9e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 95% (41/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and exhibit normal hematological parameters. However, when fed a low iron diet, female homozygotes display a decrease in liver iron content and are able to maintain normal serum iron levels and transferrin saturation, unlike wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,629,140 Q854* probably null Het
Arl2bp G T 8: 94,667,166 probably benign Het
Astl T C 2: 127,345,965 M121T probably benign Het
Atrip T C 9: 109,067,014 probably null Het
Camk1g A T 1: 193,359,809 V44E probably benign Het
Cc2d2a A G 5: 43,709,113 H804R probably benign Het
Cd300a T C 11: 114,901,273 S314P probably damaging Het
Ceacam5 A T 7: 17,750,652 I440L possibly damaging Het
Cfap61 T G 2: 146,001,912 I306R probably benign Het
Cnot10 T C 9: 114,617,719 probably null Het
Cntln T A 4: 85,100,385 L76Q probably damaging Het
Cobl A G 11: 12,254,795 C636R probably benign Het
Dnm3 A T 1: 162,019,843 H148Q probably damaging Het
Dot1l T A 10: 80,792,245 L1039Q probably benign Het
Faiml T A 9: 99,236,347 M1L unknown Het
Fat1 T G 8: 44,989,108 I1149S possibly damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm11938 A T 11: 99,603,084 C62S probably damaging Het
Gm15448 A G 7: 3,821,668 S573P unknown Het
Gtf2i A G 5: 134,263,621 L423S probably damaging Het
Hmcn1 A T 1: 150,604,102 C4582S probably damaging Het
Ifitm3 A G 7: 141,010,524 V41A probably benign Het
Ipo11 T A 13: 106,925,096 S19C probably damaging Het
Khsrp C A 17: 57,025,386 M268I possibly damaging Het
Lrp1b T G 2: 41,408,264 D1036A Het
Mecom T G 3: 29,980,708 H273P probably damaging Het
Mfn1 G A 3: 32,568,395 V601I probably benign Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Myo18a A G 11: 77,823,827 T811A probably damaging Het
Olfr318 C A 11: 58,720,158 V297F possibly damaging Het
Otog T A 7: 46,267,323 C895S probably damaging Het
Pacs1 A T 19: 5,156,374 I261N possibly damaging Het
Ptprn A T 1: 75,260,619 M113K possibly damaging Het
Rag1 T C 2: 101,643,462 H445R probably damaging Het
Ranbp2 T G 10: 58,492,837 F2853V probably damaging Het
Skint5 A T 4: 113,779,080 F647Y unknown Het
Stt3b T C 9: 115,254,017 Y449C probably damaging Het
Ythdc2 A G 18: 44,845,788 D455G probably benign Het
Zfp451 A C 1: 33,776,744 D708E possibly damaging Het
Zfp456 T C 13: 67,372,777 E33G probably damaging Het
Zfp599 T C 9: 22,258,096 T27A probably benign Het
Other mutations in Ndfip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Bridge_too_far UTSW 14 105294857 missense probably damaging 1.00
PIT4486001:Ndfip2 UTSW 14 105294866 missense probably damaging 1.00
R0189:Ndfip2 UTSW 14 105304740 missense probably damaging 1.00
R2156:Ndfip2 UTSW 14 105287770 missense probably benign 0.07
R4912:Ndfip2 UTSW 14 105258685 missense probably benign 0.00
R5102:Ndfip2 UTSW 14 105298105 missense possibly damaging 0.65
R5759:Ndfip2 UTSW 14 105302316 synonymous probably null
R5893:Ndfip2 UTSW 14 105294857 missense probably damaging 1.00
R6152:Ndfip2 UTSW 14 105298104 missense possibly damaging 0.79
R6645:Ndfip2 UTSW 14 105292273 missense probably damaging 1.00
R7196:Ndfip2 UTSW 14 105298038 missense probably damaging 1.00
R7699:Ndfip2 UTSW 14 105287759 missense possibly damaging 0.63
R7700:Ndfip2 UTSW 14 105287759 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TCACAGAAGTTTGCAATCGCG -3'
(R):5'- CCCTATGTTGGTAAGAAGCAAAGTG -3'

Sequencing Primer
(F):5'- GCAATCGCGTAAGAGTTTCTTC -3'
(R):5'- AAGTGGGAGCCAACCTTCCTTC -3'
Posted On2019-05-15