Incidental Mutation 'R7074:Cplx1'
ID549093
Institutional Source Beutler Lab
Gene Symbol Cplx1
Ensembl Gene ENSMUSG00000033615
Gene Namecomplexin 1
Synonyms921-S
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7074 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location108518554-108550024 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 108548527 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046892] [ENSMUST00000129040] [ENSMUST00000129040]
Predicted Effect probably benign
Transcript: ENSMUST00000046892
AA Change: V4M

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000038502
Gene: ENSMUSG00000033615
AA Change: V4M

DomainStartEndE-ValueType
Pfam:Synaphin 1 133 2.2e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000129040
SMART Domains Protein: ENSMUSP00000118118
Gene: ENSMUSG00000033615

DomainStartEndE-ValueType
Pfam:Synaphin 1 77 2.6e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000129040
SMART Domains Protein: ENSMUSP00000118118
Gene: ENSMUSG00000033615

DomainStartEndE-ValueType
Pfam:Synaphin 1 77 2.6e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196046
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins encoded by the complexin/synaphin gene family are cytosolic proteins that function in synaptic vesicle exocytosis. These proteins bind syntaxin, part of the SNAP receptor. The protein product of this gene binds to the SNAP receptor complex and disrupts it, allowing transmitter release. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene suffer from ataxia, are unable to reproduce, and die within 2-4 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A T 4: 144,613,863 I53L probably benign Het
Acss2 T C 2: 155,522,041 L80P possibly damaging Het
Adam3 A T 8: 24,694,347 F546I probably benign Het
Adtrp A T 13: 41,828,141 probably null Het
Anapc1 G T 2: 128,678,274 P208T probably damaging Het
Ankrd33 A G 15: 101,119,549 K281R probably benign Het
Bcl11b A G 12: 107,989,507 S128P probably benign Het
Ccdc57 T C 11: 120,903,374 K265E possibly damaging Het
Cep72 A G 13: 74,051,580 C244R probably benign Het
Cope A G 8: 70,312,887 Q303R probably benign Het
Cpd T A 11: 76,813,594 N398I probably damaging Het
Dixdc1 T A 9: 50,689,914 E344D possibly damaging Het
Dock7 A T 4: 98,945,208 F1951I unknown Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Faap24 A T 7: 35,395,102 I91K possibly damaging Het
Fubp3 T C 2: 31,595,294 S107P probably damaging Het
Gas2l2 T A 11: 83,423,067 Q473L probably benign Het
Ghr A T 15: 3,333,391 Y200N probably damaging Het
Gm4950 G A 18: 51,865,449 Q145* probably null Het
Gm826 C T 2: 160,311,890 V78I unknown Het
Gnas G A 2: 174,285,049 E126K probably damaging Het
Grip2 A T 6: 91,784,708 V235E probably benign Het
Hmgcl A G 4: 135,953,867 H88R probably benign Het
Htr7 A G 19: 36,056,883 V124A probably damaging Het
Igf2r T A 17: 12,714,116 I840F possibly damaging Het
Ints8 T C 4: 11,204,574 I961V possibly damaging Het
Jmy A T 13: 93,453,931 S555T probably benign Het
Klk1b27 G A 7: 44,056,553 G227S probably damaging Het
Lao1 A C 4: 118,968,185 T401P probably damaging Het
Lrwd1 C T 5: 136,123,657 V547I probably benign Het
Mttp C A 3: 138,107,273 R532L possibly damaging Het
Muc16 T C 9: 18,655,650 T1858A unknown Het
Myo18a T A 11: 77,842,561 D1409E probably benign Het
Ncor2 T A 5: 125,049,366 R554* probably null Het
Olfr127 T A 17: 37,903,827 Y94N possibly damaging Het
Olfr168 T A 16: 19,530,105 I272F possibly damaging Het
Olfr222 T C 11: 59,571,009 T244A probably damaging Het
Olfr22-ps1 A T 11: 73,955,149 H153L probably benign Het
Olfr690 A G 7: 105,329,268 M308T probably benign Het
Prkar2b A G 12: 31,972,148 Y213H probably damaging Het
Prkd3 T A 17: 78,974,807 K306* probably null Het
Psd2 A G 18: 36,010,684 E681G probably benign Het
Sel1l2 T A 2: 140,263,442 N276I probably damaging Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Smyd1 A G 6: 71,237,375 V214A probably damaging Het
Spag5 T C 11: 78,305,042 probably null Het
Trem3 C T 17: 48,249,881 R127W probably damaging Het
Ttn G A 2: 76,918,081 T4208I probably benign Het
Tubgcp6 A G 15: 89,120,636 F260S probably damaging Het
Vmn1r51 A T 6: 90,129,672 D190V probably benign Het
Zc3h14 A G 12: 98,758,600 I174V possibly damaging Het
Zfp423 G A 8: 87,782,432 T428I probably benign Het
Zfp608 T A 18: 54,897,382 N1162I possibly damaging Het
Zmym5 T C 14: 56,804,798 M8V probably benign Het
Other mutations in Cplx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:Cplx1 APN 5 108548527 splice site probably null
IGL02588:Cplx1 APN 5 108525423 missense possibly damaging 0.71
hillbilly UTSW 5 108520165 nonsense probably null
R1227:Cplx1 UTSW 5 108525396 missense possibly damaging 0.92
R6666:Cplx1 UTSW 5 108520165 nonsense probably null
R7002:Cplx1 UTSW 5 108520316 missense probably damaging 0.98
R7618:Cplx1 UTSW 5 108525529 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CTTAGGCTTGTTCAGAGTGTAAGC -3'
(R):5'- TGTGGGAACAAAGCCTCTCAC -3'

Sequencing Primer
(F):5'- GTTCAGAGTGTAAGCAACCATCTGC -3'
(R):5'- CACCCTAGACTCTTGGGATAGTG -3'
Posted On2019-05-15