Incidental Mutation 'R7085:Cntrl'
ID549803
Institutional Source Beutler Lab
Gene Symbol Cntrl
Ensembl Gene ENSMUSG00000057110
Gene Namecentriolin
Synonyms6720467O09Rik, Cep110, IB3/5, Ma2a8, b2b1468Clo, Cep1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R7085 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location35109492-35178822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35165792 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 1786 (C1786S)
Ref Sequence ENSEMBL: ENSMUSP00000108655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028237] [ENSMUST00000113032] [ENSMUST00000113037] [ENSMUST00000124081] [ENSMUST00000156933]
Predicted Effect probably benign
Transcript: ENSMUST00000028237
AA Change: C1787S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000028237
Gene: ENSMUSG00000057110
AA Change: C1787S

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
LRR 146 167 2.54e1 SMART
LRR 168 190 3.24e0 SMART
LRR 192 214 7.16e0 SMART
Blast:LRR 217 239 8e-6 BLAST
low complexity region 275 292 N/A INTRINSIC
coiled coil region 437 800 N/A INTRINSIC
coiled coil region 858 971 N/A INTRINSIC
low complexity region 975 995 N/A INTRINSIC
coiled coil region 998 1102 N/A INTRINSIC
internal_repeat_1 1119 1132 1.95e-5 PROSPERO
low complexity region 1153 1161 N/A INTRINSIC
low complexity region 1268 1301 N/A INTRINSIC
coiled coil region 1320 1629 N/A INTRINSIC
coiled coil region 1661 2155 N/A INTRINSIC
low complexity region 2193 2208 N/A INTRINSIC
internal_repeat_1 2252 2265 1.95e-5 PROSPERO
low complexity region 2289 2307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113032
AA Change: C1786S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108655
Gene: ENSMUSG00000057110
AA Change: C1786S

DomainStartEndE-ValueType
low complexity region 20 53 N/A INTRINSIC
coiled coil region 72 381 N/A INTRINSIC
coiled coil region 413 907 N/A INTRINSIC
low complexity region 945 960 N/A INTRINSIC
coiled coil region 989 1011 N/A INTRINSIC
low complexity region 1041 1059 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113037
AA Change: C1233S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108660
Gene: ENSMUSG00000057110
AA Change: C1233S

DomainStartEndE-ValueType
coiled coil region 1 247 N/A INTRINSIC
internal_repeat_3 261 278 5.34e-5 PROSPERO
coiled coil region 305 548 N/A INTRINSIC
internal_repeat_1 565 578 1.42e-6 PROSPERO
internal_repeat_2 567 595 2.58e-5 PROSPERO
low complexity region 599 607 N/A INTRINSIC
internal_repeat_2 625 652 2.58e-5 PROSPERO
low complexity region 714 747 N/A INTRINSIC
coiled coil region 766 1075 N/A INTRINSIC
internal_repeat_3 1094 1111 5.34e-5 PROSPERO
low complexity region 1183 1223 N/A INTRINSIC
low complexity region 1343 1355 N/A INTRINSIC
low complexity region 1365 1387 N/A INTRINSIC
low complexity region 1399 1414 N/A INTRINSIC
low complexity region 1420 1431 N/A INTRINSIC
low complexity region 1639 1654 N/A INTRINSIC
internal_repeat_1 1698 1711 1.42e-6 PROSPERO
low complexity region 1735 1753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124081
SMART Domains Protein: ENSMUSP00000143087
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
coiled coil region 1 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156933
AA Change: C1787S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000118731
Gene: ENSMUSG00000057110
AA Change: C1787S

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
LRR 146 167 2.54e1 SMART
LRR 168 190 3.24e0 SMART
LRR 192 214 7.16e0 SMART
Blast:LRR 217 239 7e-6 BLAST
low complexity region 275 292 N/A INTRINSIC
coiled coil region 437 800 N/A INTRINSIC
coiled coil region 858 971 N/A INTRINSIC
low complexity region 975 995 N/A INTRINSIC
coiled coil region 998 1102 N/A INTRINSIC
internal_repeat_1 1119 1132 1.65e-5 PROSPERO
low complexity region 1153 1161 N/A INTRINSIC
low complexity region 1268 1301 N/A INTRINSIC
coiled coil region 1320 1629 N/A INTRINSIC
coiled coil region 1661 2155 N/A INTRINSIC
low complexity region 2193 2208 N/A INTRINSIC
internal_repeat_1 2252 2265 1.65e-5 PROSPERO
low complexity region 2289 2307 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (75/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein required for the centrosome to function as a microtubule organizing center. The gene product is also associated with centrosome maturation. One version of stem cell myeloproliferative disorder is the result of a reciprocal translocation between chromosomes 8 and 9, with the breakpoint associated with fibroblast growth factor receptor 1 and centrosomal protein 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit cardiac defects, including double outlet right ventricle, atrial septal defects, ventricular septal defects, tricuspid valve stenosis and heart right ventricle hypoplasia, and develop kidney cysts and hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A G 1: 26,683,465 L878P possibly damaging Het
9330159F19Rik T C 10: 29,224,480 L283P probably damaging Het
Abhd18 T C 3: 40,916,909 M132T possibly damaging Het
Afap1l1 A G 18: 61,748,814 V270A possibly damaging Het
Ankrd34a A T 3: 96,598,629 Q383L probably benign Het
Atp8b5 A G 4: 43,361,835 D627G probably damaging Het
Atrnl1 T A 19: 57,691,857 C730S probably damaging Het
Bclaf1 T C 10: 20,322,022 S4P unknown Het
Blzf1 T C 1: 164,302,324 D153G probably damaging Het
Btaf1 T C 19: 36,972,918 V516A probably benign Het
C1qa T C 4: 136,897,780 T20A probably benign Het
Cacna1e A T 1: 154,473,746 probably null Het
Cfd T G 10: 79,892,492 V229G probably damaging Het
Chd3 T A 11: 69,369,201 H64L unknown Het
Cntn3 A G 6: 102,165,401 S1002P possibly damaging Het
Cpa1 A G 6: 30,643,620 D355G probably benign Het
D130043K22Rik T C 13: 24,872,302 V539A possibly damaging Het
Ddx1 A C 12: 13,229,355 W428G probably damaging Het
Ddx49 G A 8: 70,302,483 probably benign Het
Dnhd1 T A 7: 105,715,261 V4207E probably benign Het
Dock3 A G 9: 106,901,887 S288P probably damaging Het
Drap1 G A 19: 5,424,787 probably benign Het
Ecm2 G A 13: 49,520,902 R266K probably damaging Het
Emilin2 A G 17: 71,274,105 L542S probably damaging Het
Evx1 T C 6: 52,316,692 Y282H possibly damaging Het
Fam159b G T 13: 104,858,306 T111K probably benign Het
Fbxo44 T A 4: 148,158,743 H20L probably damaging Het
Flot2 G T 11: 78,058,074 A292S possibly damaging Het
Fry A G 5: 150,438,749 I2161V probably benign Het
Gli3 T C 13: 15,715,062 F587S probably damaging Het
Gm10697 T A 3: 94,072,632 M5L probably benign Het
Gm4450 T C 3: 98,450,394 N101D probably damaging Het
Gm49368 A G 7: 128,126,857 D1147G unknown Het
Gm6970 A G 19: 47,170,662 V158A unknown Het
Gprc5b A T 7: 118,983,632 M338K probably damaging Het
Hacd3 A C 9: 64,998,243 N204K probably damaging Het
Hydin A G 8: 110,603,330 T4899A probably benign Het
Ido2 T A 8: 24,558,196 R49S probably benign Het
Igsf3 C A 3: 101,455,489 T942K probably benign Het
Kank4 T A 4: 98,779,946 Q88L probably benign Het
Krtap16-1 T A 11: 99,986,285 I98F possibly damaging Het
Laptm4a T C 12: 8,922,113 V52A probably benign Het
Lmbr1 A T 5: 29,361,092 probably null Het
Lnx1 G A 5: 74,628,185 S31F possibly damaging Het
Mafa G T 15: 75,747,687 A79E unknown Het
Me2 A T 18: 73,781,058 N467K probably damaging Het
Med23 T A 10: 24,870,121 L8Q probably damaging Het
Muc16 T A 9: 18,644,849 I3383F unknown Het
Nbas G T 12: 13,285,258 S151I probably damaging Het
Olfr1130 T A 2: 87,607,406 I6N probably benign Het
Olfr231 T A 1: 174,117,660 I119F probably damaging Het
Olfr272 C T 4: 52,910,961 A278T probably benign Het
Olfr867 G A 9: 20,054,936 H58Y probably benign Het
Olfr976 C A 9: 39,956,512 C141F probably damaging Het
Piezo1 A G 8: 122,490,894 V1305A Het
Plcb3 T C 19: 6,960,133 E639G possibly damaging Het
Polr2a A G 11: 69,743,880 L658P probably damaging Het
Prag1 A T 8: 36,104,237 Q658L possibly damaging Het
Prex2 A T 1: 11,098,588 R269S possibly damaging Het
Reln C A 5: 21,915,087 G2856* probably null Het
Rsph10b A T 5: 143,949,284 T267S possibly damaging Het
Rtn4rl1 A G 11: 75,265,224 I161V probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sbno1 G A 5: 124,381,720 P1165L possibly damaging Het
Scn3b T C 9: 40,277,098 V29A probably damaging Het
Sh3d21 T A 4: 126,163,091 T13S probably benign Het
Slc22a22 G A 15: 57,249,649 T398I probably benign Het
Slc40a1 T A 1: 45,911,528 T255S probably benign Het
Smchd1 A T 17: 71,365,219 probably null Het
Soat1 A T 1: 156,432,331 V480D probably damaging Het
Supt5 T A 7: 28,331,489 E39V unknown Het
Tapbpl T C 6: 125,226,488 probably null Het
Tlr11 A T 14: 50,362,656 I700F probably damaging Het
Tmc3 A T 7: 83,622,145 K864M possibly damaging Het
Tns1 G A 1: 73,925,462 P81S probably benign Het
Tspan2 C A 3: 102,760,954 L168I probably benign Het
Unc13d C A 11: 116,064,807 S885I probably benign Het
Unc45a A T 7: 80,326,334 M799K possibly damaging Het
Usp34 A G 11: 23,363,097 D547G Het
Vps33b A G 7: 80,276,089 I95V probably benign Het
Other mutations in Cntrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cntrl APN 2 35137814 splice site probably benign
IGL00478:Cntrl APN 2 35160601 missense probably damaging 0.98
IGL01460:Cntrl APN 2 35165844 missense probably benign 0.04
IGL01556:Cntrl APN 2 35173059 missense probably benign 0.19
IGL02155:Cntrl APN 2 35160238 splice site probably benign
IGL02419:Cntrl APN 2 35134043 missense probably damaging 0.97
PIT4480001:Cntrl UTSW 2 35155428 missense probably damaging 0.96
R0179:Cntrl UTSW 2 35167859 missense probably benign 0.00
R0276:Cntrl UTSW 2 35151732 missense possibly damaging 0.62
R0471:Cntrl UTSW 2 35127380 missense probably benign 0.41
R0755:Cntrl UTSW 2 35145139 missense probably damaging 1.00
R0763:Cntrl UTSW 2 35171066 missense probably benign
R0781:Cntrl UTSW 2 35160627 missense possibly damaging 0.66
R0791:Cntrl UTSW 2 35155279 missense possibly damaging 0.83
R0792:Cntrl UTSW 2 35155279 missense possibly damaging 0.83
R0801:Cntrl UTSW 2 35175095 splice site probably benign
R1067:Cntrl UTSW 2 35149022 unclassified probably benign
R1110:Cntrl UTSW 2 35160627 missense possibly damaging 0.66
R1117:Cntrl UTSW 2 35127973 missense probably damaging 1.00
R1457:Cntrl UTSW 2 35122756 missense probably benign 0.00
R1472:Cntrl UTSW 2 35169317 critical splice donor site probably null
R1522:Cntrl UTSW 2 35155279 missense possibly damaging 0.83
R1702:Cntrl UTSW 2 35171836 critical splice acceptor site probably null
R1762:Cntrl UTSW 2 35122806 frame shift probably null
R1785:Cntrl UTSW 2 35122806 frame shift probably null
R1786:Cntrl UTSW 2 35122806 frame shift probably null
R1812:Cntrl UTSW 2 35149469 missense probably damaging 0.97
R1854:Cntrl UTSW 2 35122684 missense probably damaging 1.00
R1863:Cntrl UTSW 2 35118119 missense possibly damaging 0.93
R1868:Cntrl UTSW 2 35129815 missense probably benign 0.03
R1914:Cntrl UTSW 2 35162861 missense probably benign 0.00
R1915:Cntrl UTSW 2 35162861 missense probably benign 0.00
R2049:Cntrl UTSW 2 35122806 frame shift probably null
R2118:Cntrl UTSW 2 35161965 missense probably benign 0.31
R2140:Cntrl UTSW 2 35122806 frame shift probably null
R2142:Cntrl UTSW 2 35122806 frame shift probably null
R2203:Cntrl UTSW 2 35143737 missense possibly damaging 0.84
R2300:Cntrl UTSW 2 35127513 missense probably benign 0.00
R2349:Cntrl UTSW 2 35176251 missense probably benign 0.18
R2374:Cntrl UTSW 2 35153276 missense possibly damaging 0.46
R3429:Cntrl UTSW 2 35145100 missense probably damaging 1.00
R3890:Cntrl UTSW 2 35170480 missense probably benign 0.02
R3911:Cntrl UTSW 2 35120049 missense probably damaging 1.00
R3922:Cntrl UTSW 2 35129739 missense probably damaging 0.98
R4081:Cntrl UTSW 2 35161926 splice site probably benign
R4081:Cntrl UTSW 2 35175125 missense probably damaging 1.00
R4516:Cntrl UTSW 2 35127981 missense probably benign 0.00
R4518:Cntrl UTSW 2 35148974 missense probably damaging 1.00
R4519:Cntrl UTSW 2 35173111 missense probably damaging 1.00
R4646:Cntrl UTSW 2 35149461 missense probably damaging 0.99
R4753:Cntrl UTSW 2 35153439 missense possibly damaging 0.90
R4763:Cntrl UTSW 2 35175551 missense probably damaging 1.00
R4916:Cntrl UTSW 2 35165682 missense probably benign 0.42
R5168:Cntrl UTSW 2 35157655 missense probably damaging 1.00
R5291:Cntrl UTSW 2 35134060 missense probably damaging 1.00
R5356:Cntrl UTSW 2 35148899 nonsense probably null
R5774:Cntrl UTSW 2 35162861 missense probably benign 0.15
R5947:Cntrl UTSW 2 35116679 missense probably damaging 1.00
R6144:Cntrl UTSW 2 35165733 missense possibly damaging 0.93
R6147:Cntrl UTSW 2 35165733 missense possibly damaging 0.93
R6214:Cntrl UTSW 2 35129634 missense probably benign 0.10
R6267:Cntrl UTSW 2 35129793 missense probably damaging 1.00
R6332:Cntrl UTSW 2 35128024 missense possibly damaging 0.78
R6445:Cntrl UTSW 2 35162848 missense probably benign 0.05
R6487:Cntrl UTSW 2 35122682 missense possibly damaging 0.89
R6497:Cntrl UTSW 2 35135572 missense possibly damaging 0.66
R6782:Cntrl UTSW 2 35170646 missense possibly damaging 0.75
R6815:Cntrl UTSW 2 35149491 missense probably damaging 1.00
R6853:Cntrl UTSW 2 35129821 missense possibly damaging 0.87
R6858:Cntrl UTSW 2 35162095 critical splice donor site probably null
R6965:Cntrl UTSW 2 35162833 missense probably benign 0.20
R6970:Cntrl UTSW 2 35118137 missense probably benign
R7150:Cntrl UTSW 2 35165445 critical splice acceptor site probably null
R7213:Cntrl UTSW 2 35135680 missense possibly damaging 0.95
R7221:Cntrl UTSW 2 35151857 missense possibly damaging 0.46
R7389:Cntrl UTSW 2 35127517 missense probably benign 0.01
R7414:Cntrl UTSW 2 35165467 missense probably benign 0.02
R7427:Cntrl UTSW 2 35170534 missense probably benign 0.00
R7428:Cntrl UTSW 2 35170534 missense probably benign 0.00
R7453:Cntrl UTSW 2 35155409 missense possibly damaging 0.89
R7747:Cntrl UTSW 2 35116798 missense probably damaging 1.00
R7753:Cntrl UTSW 2 35111679 missense probably damaging 1.00
R7811:Cntrl UTSW 2 35162861 missense probably benign 0.00
R7882:Cntrl UTSW 2 35170580 missense probably benign 0.41
R7919:Cntrl UTSW 2 35127401 missense probably benign
R8314:Cntrl UTSW 2 35175143 missense probably benign 0.00
R8332:Cntrl UTSW 2 35126025 missense probably damaging 1.00
RF007:Cntrl UTSW 2 35170500 missense probably benign
RF016:Cntrl UTSW 2 35119986 missense probably benign
RF017:Cntrl UTSW 2 35175189 missense probably damaging 0.96
X0024:Cntrl UTSW 2 35147296 missense probably damaging 1.00
X0026:Cntrl UTSW 2 35149516 missense probably damaging 1.00
X0027:Cntrl UTSW 2 35157768 missense probably damaging 1.00
X0027:Cntrl UTSW 2 35165682 missense probably benign 0.08
X0028:Cntrl UTSW 2 35147344 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCAAGGTGTCTGAATCTTCTCTC -3'
(R):5'- GCAGTGAACAAAATCTTCCTTTCTA -3'

Sequencing Primer
(F):5'- TTCTCTCTCACTCAGGAGAAACTAG -3'
(R):5'- CATAGGCCTTGAACTCGGAGATCTG -3'
Posted On2019-05-15