Incidental Mutation 'R6267:Cntrl'
ID 507049
Institutional Source Beutler Lab
Gene Symbol Cntrl
Ensembl Gene ENSMUSG00000057110
Gene Name centriolin
Synonyms IB3/5, b2b1468Clo, Cep1, 6720467O09Rik, Ma2a8, Cep110
MMRRC Submission 044405-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.915) question?
Stock # R6267 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 34999504-35068834 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35019805 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 544 (L544P)
Ref Sequence ENSEMBL: ENSMUSP00000118731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028235] [ENSMUST00000028237] [ENSMUST00000113032] [ENSMUST00000113033] [ENSMUST00000113034] [ENSMUST00000113037] [ENSMUST00000156933] [ENSMUST00000150807]
AlphaFold A2AL36
Predicted Effect probably damaging
Transcript: ENSMUST00000028235
AA Change: L544P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028235
Gene: ENSMUSG00000057110
AA Change: L544P

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
LRR 146 167 2.54e1 SMART
LRR 168 190 3.24e0 SMART
LRR 192 214 7.16e0 SMART
Blast:LRR 217 239 7e-6 BLAST
low complexity region 275 292 N/A INTRINSIC
coiled coil region 437 540 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000028237
AA Change: L544P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028237
Gene: ENSMUSG00000057110
AA Change: L544P

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
LRR 146 167 2.54e1 SMART
LRR 168 190 3.24e0 SMART
LRR 192 214 7.16e0 SMART
Blast:LRR 217 239 8e-6 BLAST
low complexity region 275 292 N/A INTRINSIC
coiled coil region 437 800 N/A INTRINSIC
coiled coil region 858 971 N/A INTRINSIC
low complexity region 975 995 N/A INTRINSIC
coiled coil region 998 1102 N/A INTRINSIC
internal_repeat_1 1119 1132 1.95e-5 PROSPERO
low complexity region 1153 1161 N/A INTRINSIC
low complexity region 1268 1301 N/A INTRINSIC
coiled coil region 1320 1629 N/A INTRINSIC
coiled coil region 1661 2155 N/A INTRINSIC
low complexity region 2193 2208 N/A INTRINSIC
internal_repeat_1 2252 2265 1.95e-5 PROSPERO
low complexity region 2289 2307 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113032
AA Change: L544P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108655
Gene: ENSMUSG00000057110
AA Change: L544P

DomainStartEndE-ValueType
low complexity region 20 53 N/A INTRINSIC
coiled coil region 72 381 N/A INTRINSIC
coiled coil region 413 907 N/A INTRINSIC
low complexity region 945 960 N/A INTRINSIC
coiled coil region 989 1011 N/A INTRINSIC
low complexity region 1041 1059 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113033
SMART Domains Protein: ENSMUSP00000108656
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
coiled coil region 1 247 N/A INTRINSIC
coiled coil region 305 418 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113034
SMART Domains Protein: ENSMUSP00000108657
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
coiled coil region 1 247 N/A INTRINSIC
internal_repeat_3 261 278 5.68e-5 PROSPERO
coiled coil region 305 418 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
coiled coil region 445 549 N/A INTRINSIC
internal_repeat_1 566 579 1.52e-6 PROSPERO
internal_repeat_2 568 596 2.75e-5 PROSPERO
low complexity region 600 608 N/A INTRINSIC
internal_repeat_2 626 653 2.75e-5 PROSPERO
low complexity region 715 748 N/A INTRINSIC
coiled coil region 767 1076 N/A INTRINSIC
internal_repeat_3 1095 1112 5.68e-5 PROSPERO
low complexity region 1184 1224 N/A INTRINSIC
low complexity region 1344 1356 N/A INTRINSIC
low complexity region 1366 1388 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1421 1432 N/A INTRINSIC
low complexity region 1640 1655 N/A INTRINSIC
internal_repeat_1 1699 1712 1.52e-6 PROSPERO
low complexity region 1736 1754 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113037
SMART Domains Protein: ENSMUSP00000108660
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
coiled coil region 1 247 N/A INTRINSIC
internal_repeat_3 261 278 5.34e-5 PROSPERO
coiled coil region 305 548 N/A INTRINSIC
internal_repeat_1 565 578 1.42e-6 PROSPERO
internal_repeat_2 567 595 2.58e-5 PROSPERO
low complexity region 599 607 N/A INTRINSIC
internal_repeat_2 625 652 2.58e-5 PROSPERO
low complexity region 714 747 N/A INTRINSIC
coiled coil region 766 1075 N/A INTRINSIC
internal_repeat_3 1094 1111 5.34e-5 PROSPERO
low complexity region 1183 1223 N/A INTRINSIC
low complexity region 1343 1355 N/A INTRINSIC
low complexity region 1365 1387 N/A INTRINSIC
low complexity region 1399 1414 N/A INTRINSIC
low complexity region 1420 1431 N/A INTRINSIC
low complexity region 1639 1654 N/A INTRINSIC
internal_repeat_1 1698 1711 1.42e-6 PROSPERO
low complexity region 1735 1753 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156933
AA Change: L544P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118731
Gene: ENSMUSG00000057110
AA Change: L544P

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
LRR 146 167 2.54e1 SMART
LRR 168 190 3.24e0 SMART
LRR 192 214 7.16e0 SMART
Blast:LRR 217 239 7e-6 BLAST
low complexity region 275 292 N/A INTRINSIC
coiled coil region 437 800 N/A INTRINSIC
coiled coil region 858 971 N/A INTRINSIC
low complexity region 975 995 N/A INTRINSIC
coiled coil region 998 1102 N/A INTRINSIC
internal_repeat_1 1119 1132 1.65e-5 PROSPERO
low complexity region 1153 1161 N/A INTRINSIC
low complexity region 1268 1301 N/A INTRINSIC
coiled coil region 1320 1629 N/A INTRINSIC
coiled coil region 1661 2155 N/A INTRINSIC
low complexity region 2193 2208 N/A INTRINSIC
internal_repeat_1 2252 2265 1.65e-5 PROSPERO
low complexity region 2289 2307 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000123884
AA Change: L144P
SMART Domains Protein: ENSMUSP00000119760
Gene: ENSMUSG00000057110
AA Change: L144P

DomainStartEndE-ValueType
coiled coil region 37 400 N/A INTRINSIC
coiled coil region 458 571 N/A INTRINSIC
low complexity region 576 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150807
SMART Domains Protein: ENSMUSP00000142683
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
coiled coil region 1 140 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein required for the centrosome to function as a microtubule organizing center. The gene product is also associated with centrosome maturation. One version of stem cell myeloproliferative disorder is the result of a reciprocal translocation between chromosomes 8 and 9, with the breakpoint associated with fibroblast growth factor receptor 1 and centrosomal protein 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit cardiac defects, including double outlet right ventricle, atrial septal defects, ventricular septal defects, tricuspid valve stenosis and heart right ventricle hypoplasia, and develop kidney cysts and hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,086,580 (GRCm39) K277R probably damaging Het
Aatf T C 11: 84,363,926 (GRCm39) Y267C probably benign Het
Abi3bp A G 16: 56,414,860 (GRCm39) T341A probably damaging Het
Acer2 T C 4: 86,792,823 (GRCm39) F33S probably damaging Het
Actr1b A G 1: 36,740,244 (GRCm39) V299A possibly damaging Het
Ampd3 T A 7: 110,390,387 (GRCm39) probably null Het
Atm A C 9: 53,355,300 (GRCm39) I2898R probably damaging Het
Bpifb6 G C 2: 153,748,812 (GRCm39) K269N possibly damaging Het
Cacna1c T C 6: 118,575,684 (GRCm39) E1927G possibly damaging Het
Cacna1c T A 6: 118,629,675 (GRCm39) T1249S probably benign Het
Cars2 TCCCC TCCC 8: 11,579,599 (GRCm39) probably null Het
Cbll1 A G 12: 31,537,507 (GRCm39) V415A probably benign Het
Cd300lf C T 11: 115,015,195 (GRCm39) V132I probably benign Het
Chd2 T C 7: 73,113,419 (GRCm39) E1187G probably damaging Het
Cryga A C 1: 65,142,169 (GRCm39) S75A probably benign Het
Dcbld1 T A 10: 52,195,576 (GRCm39) Y261* probably null Het
Ddx11 G A 17: 66,457,724 (GRCm39) probably null Het
Dgke C T 11: 88,931,575 (GRCm39) V560I probably benign Het
Dst A C 1: 34,267,753 (GRCm39) D5065A probably damaging Het
Dusp16 C A 6: 134,697,456 (GRCm39) probably null Het
Eif4enif1 T A 11: 3,177,793 (GRCm39) V395E probably damaging Het
Enox1 A G 14: 77,815,204 (GRCm39) T121A probably damaging Het
Enpp4 G T 17: 44,413,371 (GRCm39) N54K probably benign Het
Erc2 A T 14: 27,802,112 (GRCm39) K764M probably damaging Het
Ercc6 G T 14: 32,248,360 (GRCm39) E304* probably null Het
Fam117a T A 11: 95,254,971 (GRCm39) C115S possibly damaging Het
Fcrl5 G A 3: 87,355,631 (GRCm39) G448E probably damaging Het
Galntl5 T C 5: 25,391,163 (GRCm39) S21P probably benign Het
Garnl3 T C 2: 32,994,892 (GRCm39) D39G probably benign Het
Gm14295 C T 2: 176,500,782 (GRCm39) Q91* probably null Het
Grb10 T A 11: 11,920,639 (GRCm39) probably benign Het
Grip1 C T 10: 119,911,369 (GRCm39) Q696* probably null Het
Herc2 T A 7: 55,802,914 (GRCm39) C2112* probably null Het
Herc2 T G 7: 55,854,466 (GRCm39) L3797R possibly damaging Het
Ighm T C 12: 113,385,187 (GRCm39) I258V unknown Het
Jarid2 T A 13: 45,056,539 (GRCm39) Y443N possibly damaging Het
Kif13b A G 14: 64,976,083 (GRCm39) Y466C probably damaging Het
Krtap4-6 T A 11: 99,556,245 (GRCm39) R161* probably null Het
Lingo4 G A 3: 94,310,697 (GRCm39) G545E probably benign Het
Lmo2 T G 2: 103,800,946 (GRCm39) V39G possibly damaging Het
Loricrin C A 3: 91,989,119 (GRCm39) G56* probably null Het
Lrfn1 A G 7: 28,159,169 (GRCm39) R363G probably benign Het
Lrp1b T C 2: 40,547,537 (GRCm39) D446G probably benign Het
Ltbp1 G T 17: 75,312,984 (GRCm39) G35V possibly damaging Het
Magel2 G A 7: 62,028,427 (GRCm39) V444M probably damaging Het
Mkx A T 18: 7,000,591 (GRCm39) probably null Het
Ms4a7 A T 19: 11,310,659 (GRCm39) I20N possibly damaging Het
Myo5b A G 18: 74,750,062 (GRCm39) Y173C probably damaging Het
Nek1 C T 8: 61,525,343 (GRCm39) Q594* probably null Het
Nipbl T C 15: 8,330,379 (GRCm39) M2349V possibly damaging Het
Nmnat2 A T 1: 152,952,717 (GRCm39) H102L probably damaging Het
Nup155 T A 15: 8,182,639 (GRCm39) C1201S probably damaging Het
Or2y8 C A 11: 52,035,423 (GRCm39) R311S probably benign Het
Or4a76 G A 2: 89,460,975 (GRCm39) T89I probably damaging Het
Or52x1 G A 7: 104,852,599 (GRCm39) T317I probably damaging Het
Osbpl1a A G 18: 12,952,560 (GRCm39) probably null Het
Pcnt A G 10: 76,221,632 (GRCm39) V1998A probably benign Het
Pitpnc1 T C 11: 107,117,092 (GRCm39) H193R probably damaging Het
Pitpnm1 T C 19: 4,160,522 (GRCm39) L781P probably damaging Het
Prdm14 A T 1: 13,189,160 (GRCm39) C395S probably damaging Het
Prmt8 A G 6: 127,688,767 (GRCm39) I201T probably damaging Het
Pter T C 2: 12,983,352 (GRCm39) V119A probably damaging Het
Rab11fip4 T C 11: 79,581,655 (GRCm39) probably null Het
Rgs9 T C 11: 109,159,813 (GRCm39) N173S probably benign Het
Rorb C A 19: 18,955,221 (GRCm39) V47L possibly damaging Het
Rtn4r A G 16: 17,969,046 (GRCm39) Y158C probably damaging Het
Sdr16c5 C T 4: 4,016,162 (GRCm39) G88E probably damaging Het
Sfxn1 C T 13: 54,247,899 (GRCm39) T208I probably benign Het
Sgo2b C T 8: 64,380,827 (GRCm39) M668I probably benign Het
Slc52a3 G T 2: 151,849,529 (GRCm39) probably null Het
Smco1 A T 16: 32,092,832 (GRCm39) M168L probably benign Het
Spata31d1d G A 13: 59,876,278 (GRCm39) T419I possibly damaging Het
Spata31d1e T C 13: 59,890,497 (GRCm39) D441G probably benign Het
Spink5 T C 18: 44,147,824 (GRCm39) S857P probably damaging Het
Stk35 T A 2: 129,652,808 (GRCm39) Y436* probably null Het
Tmem225 T A 9: 40,059,731 (GRCm39) I37N probably damaging Het
Unkl T C 17: 25,450,839 (GRCm39) *232R probably null Het
Usp16 A G 16: 87,280,079 (GRCm39) N813S probably benign Het
Vmn1r128 A T 7: 21,084,221 (GRCm39) *308C probably null Het
Vmn2r45 A G 7: 8,475,207 (GRCm39) V607A probably benign Het
Vmn2r63 A T 7: 42,578,059 (GRCm39) probably null Het
Wnk4 A T 11: 101,164,824 (GRCm39) N718Y probably damaging Het
Zfp503 G C 14: 22,035,868 (GRCm39) Y349* probably null Het
Zfp990 T A 4: 145,264,673 (GRCm39) F557Y possibly damaging Het
Other mutations in Cntrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cntrl APN 2 35,027,826 (GRCm39) splice site probably benign
IGL00478:Cntrl APN 2 35,050,613 (GRCm39) missense probably damaging 0.98
IGL01460:Cntrl APN 2 35,055,856 (GRCm39) missense probably benign 0.04
IGL01556:Cntrl APN 2 35,063,071 (GRCm39) missense probably benign 0.19
IGL02155:Cntrl APN 2 35,050,250 (GRCm39) splice site probably benign
IGL02419:Cntrl APN 2 35,024,055 (GRCm39) missense probably damaging 0.97
PIT4480001:Cntrl UTSW 2 35,045,440 (GRCm39) missense probably damaging 0.96
R0179:Cntrl UTSW 2 35,057,871 (GRCm39) missense probably benign 0.00
R0276:Cntrl UTSW 2 35,041,744 (GRCm39) missense possibly damaging 0.62
R0471:Cntrl UTSW 2 35,017,392 (GRCm39) missense probably benign 0.41
R0755:Cntrl UTSW 2 35,035,151 (GRCm39) missense probably damaging 1.00
R0763:Cntrl UTSW 2 35,061,078 (GRCm39) missense probably benign
R0781:Cntrl UTSW 2 35,050,639 (GRCm39) missense possibly damaging 0.66
R0791:Cntrl UTSW 2 35,045,291 (GRCm39) missense possibly damaging 0.83
R0792:Cntrl UTSW 2 35,045,291 (GRCm39) missense possibly damaging 0.83
R0801:Cntrl UTSW 2 35,065,107 (GRCm39) splice site probably benign
R1067:Cntrl UTSW 2 35,039,034 (GRCm39) unclassified probably benign
R1110:Cntrl UTSW 2 35,050,639 (GRCm39) missense possibly damaging 0.66
R1117:Cntrl UTSW 2 35,017,985 (GRCm39) missense probably damaging 1.00
R1457:Cntrl UTSW 2 35,012,768 (GRCm39) missense probably benign 0.00
R1472:Cntrl UTSW 2 35,059,329 (GRCm39) critical splice donor site probably null
R1522:Cntrl UTSW 2 35,045,291 (GRCm39) missense possibly damaging 0.83
R1702:Cntrl UTSW 2 35,061,848 (GRCm39) critical splice acceptor site probably null
R1762:Cntrl UTSW 2 35,012,818 (GRCm39) frame shift probably null
R1785:Cntrl UTSW 2 35,012,818 (GRCm39) frame shift probably null
R1786:Cntrl UTSW 2 35,012,818 (GRCm39) frame shift probably null
R1812:Cntrl UTSW 2 35,039,481 (GRCm39) missense probably damaging 0.97
R1854:Cntrl UTSW 2 35,012,696 (GRCm39) missense probably damaging 1.00
R1863:Cntrl UTSW 2 35,008,131 (GRCm39) missense possibly damaging 0.93
R1868:Cntrl UTSW 2 35,019,827 (GRCm39) missense probably benign 0.03
R1914:Cntrl UTSW 2 35,052,873 (GRCm39) missense probably benign 0.00
R1915:Cntrl UTSW 2 35,052,873 (GRCm39) missense probably benign 0.00
R2049:Cntrl UTSW 2 35,012,818 (GRCm39) frame shift probably null
R2118:Cntrl UTSW 2 35,051,977 (GRCm39) missense probably benign 0.31
R2140:Cntrl UTSW 2 35,012,818 (GRCm39) frame shift probably null
R2142:Cntrl UTSW 2 35,012,818 (GRCm39) frame shift probably null
R2203:Cntrl UTSW 2 35,033,749 (GRCm39) missense possibly damaging 0.84
R2300:Cntrl UTSW 2 35,017,525 (GRCm39) missense probably benign 0.00
R2349:Cntrl UTSW 2 35,066,263 (GRCm39) missense probably benign 0.18
R2374:Cntrl UTSW 2 35,043,288 (GRCm39) missense possibly damaging 0.46
R3429:Cntrl UTSW 2 35,035,112 (GRCm39) missense probably damaging 1.00
R3890:Cntrl UTSW 2 35,060,492 (GRCm39) missense probably benign 0.02
R3911:Cntrl UTSW 2 35,010,061 (GRCm39) missense probably damaging 1.00
R3922:Cntrl UTSW 2 35,019,751 (GRCm39) missense probably damaging 0.98
R4081:Cntrl UTSW 2 35,065,137 (GRCm39) missense probably damaging 1.00
R4081:Cntrl UTSW 2 35,051,938 (GRCm39) splice site probably benign
R4516:Cntrl UTSW 2 35,017,993 (GRCm39) missense probably benign 0.00
R4518:Cntrl UTSW 2 35,038,986 (GRCm39) missense probably damaging 1.00
R4519:Cntrl UTSW 2 35,063,123 (GRCm39) missense probably damaging 1.00
R4646:Cntrl UTSW 2 35,039,473 (GRCm39) missense probably damaging 0.99
R4753:Cntrl UTSW 2 35,043,451 (GRCm39) missense possibly damaging 0.90
R4763:Cntrl UTSW 2 35,065,563 (GRCm39) missense probably damaging 1.00
R4916:Cntrl UTSW 2 35,055,694 (GRCm39) missense probably benign 0.42
R5168:Cntrl UTSW 2 35,047,667 (GRCm39) missense probably damaging 1.00
R5291:Cntrl UTSW 2 35,024,072 (GRCm39) missense probably damaging 1.00
R5356:Cntrl UTSW 2 35,038,911 (GRCm39) nonsense probably null
R5774:Cntrl UTSW 2 35,052,873 (GRCm39) missense probably benign 0.15
R5947:Cntrl UTSW 2 35,006,691 (GRCm39) missense probably damaging 1.00
R6144:Cntrl UTSW 2 35,055,745 (GRCm39) missense possibly damaging 0.93
R6147:Cntrl UTSW 2 35,055,745 (GRCm39) missense possibly damaging 0.93
R6214:Cntrl UTSW 2 35,019,646 (GRCm39) missense probably benign 0.10
R6332:Cntrl UTSW 2 35,018,036 (GRCm39) missense possibly damaging 0.78
R6445:Cntrl UTSW 2 35,052,860 (GRCm39) missense probably benign 0.05
R6487:Cntrl UTSW 2 35,012,694 (GRCm39) missense possibly damaging 0.89
R6497:Cntrl UTSW 2 35,025,584 (GRCm39) missense possibly damaging 0.66
R6782:Cntrl UTSW 2 35,060,658 (GRCm39) missense possibly damaging 0.75
R6815:Cntrl UTSW 2 35,039,503 (GRCm39) missense probably damaging 1.00
R6853:Cntrl UTSW 2 35,019,833 (GRCm39) missense possibly damaging 0.87
R6858:Cntrl UTSW 2 35,052,107 (GRCm39) critical splice donor site probably null
R6965:Cntrl UTSW 2 35,052,845 (GRCm39) missense probably benign 0.20
R6970:Cntrl UTSW 2 35,008,149 (GRCm39) missense probably benign
R7085:Cntrl UTSW 2 35,055,804 (GRCm39) missense probably benign 0.00
R7150:Cntrl UTSW 2 35,055,457 (GRCm39) critical splice acceptor site probably null
R7213:Cntrl UTSW 2 35,025,692 (GRCm39) missense possibly damaging 0.95
R7221:Cntrl UTSW 2 35,041,869 (GRCm39) missense possibly damaging 0.46
R7389:Cntrl UTSW 2 35,017,529 (GRCm39) missense probably benign 0.01
R7414:Cntrl UTSW 2 35,055,479 (GRCm39) missense probably benign 0.02
R7427:Cntrl UTSW 2 35,060,546 (GRCm39) missense probably benign 0.00
R7428:Cntrl UTSW 2 35,060,546 (GRCm39) missense probably benign 0.00
R7453:Cntrl UTSW 2 35,045,421 (GRCm39) missense possibly damaging 0.89
R7747:Cntrl UTSW 2 35,006,810 (GRCm39) missense probably damaging 1.00
R7753:Cntrl UTSW 2 35,001,691 (GRCm39) missense probably damaging 1.00
R7811:Cntrl UTSW 2 35,052,873 (GRCm39) missense probably benign 0.00
R7882:Cntrl UTSW 2 35,060,592 (GRCm39) missense probably benign 0.41
R7919:Cntrl UTSW 2 35,017,413 (GRCm39) missense probably benign
R8314:Cntrl UTSW 2 35,065,155 (GRCm39) missense probably benign 0.00
R8332:Cntrl UTSW 2 35,016,037 (GRCm39) missense probably damaging 1.00
R8681:Cntrl UTSW 2 35,038,600 (GRCm39) missense probably damaging 1.00
R8698:Cntrl UTSW 2 35,023,974 (GRCm39) missense probably damaging 0.98
R8717:Cntrl UTSW 2 35,003,351 (GRCm39) missense probably benign 0.40
R8960:Cntrl UTSW 2 35,052,053 (GRCm39) missense possibly damaging 0.89
R9036:Cntrl UTSW 2 35,016,071 (GRCm39) missense probably damaging 1.00
R9617:Cntrl UTSW 2 35,035,077 (GRCm39) missense probably benign 0.00
R9621:Cntrl UTSW 2 35,050,278 (GRCm39) missense probably damaging 0.96
RF007:Cntrl UTSW 2 35,060,512 (GRCm39) missense probably benign
RF016:Cntrl UTSW 2 35,009,998 (GRCm39) missense probably benign
RF017:Cntrl UTSW 2 35,065,201 (GRCm39) missense probably damaging 0.96
X0024:Cntrl UTSW 2 35,037,308 (GRCm39) missense probably damaging 1.00
X0026:Cntrl UTSW 2 35,039,528 (GRCm39) missense probably damaging 1.00
X0027:Cntrl UTSW 2 35,055,694 (GRCm39) missense probably benign 0.08
X0027:Cntrl UTSW 2 35,047,780 (GRCm39) missense probably damaging 1.00
X0028:Cntrl UTSW 2 35,037,356 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ATTTCAGAAGCAGAGAAAGACCTC -3'
(R):5'- CAAGACTAGGTGGTTCCATTTTGG -3'

Sequencing Primer
(F):5'- GAAAGACCTCCTTCTCAAGCAGTTG -3'
(R):5'- GTGGTTCCATTTTGGATATAAATGTT -3'
Posted On 2018-03-15