Incidental Mutation 'R6267:Cntrl'
ID507049
Institutional Source Beutler Lab
Gene Symbol Cntrl
Ensembl Gene ENSMUSG00000057110
Gene Namecentriolin
Synonyms6720467O09Rik, Cep110, IB3/5, Ma2a8, b2b1468Clo, Cep1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.897) question?
Stock #R6267 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location35109492-35178822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35129793 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 544 (L544P)
Ref Sequence ENSEMBL: ENSMUSP00000118731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028235] [ENSMUST00000028237] [ENSMUST00000113032] [ENSMUST00000113033] [ENSMUST00000113034] [ENSMUST00000113037] [ENSMUST00000150807] [ENSMUST00000156933]
Predicted Effect probably damaging
Transcript: ENSMUST00000028235
AA Change: L544P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028235
Gene: ENSMUSG00000057110
AA Change: L544P

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
LRR 146 167 2.54e1 SMART
LRR 168 190 3.24e0 SMART
LRR 192 214 7.16e0 SMART
Blast:LRR 217 239 7e-6 BLAST
low complexity region 275 292 N/A INTRINSIC
coiled coil region 437 540 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000028237
AA Change: L544P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028237
Gene: ENSMUSG00000057110
AA Change: L544P

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
LRR 146 167 2.54e1 SMART
LRR 168 190 3.24e0 SMART
LRR 192 214 7.16e0 SMART
Blast:LRR 217 239 8e-6 BLAST
low complexity region 275 292 N/A INTRINSIC
coiled coil region 437 800 N/A INTRINSIC
coiled coil region 858 971 N/A INTRINSIC
low complexity region 975 995 N/A INTRINSIC
coiled coil region 998 1102 N/A INTRINSIC
internal_repeat_1 1119 1132 1.95e-5 PROSPERO
low complexity region 1153 1161 N/A INTRINSIC
low complexity region 1268 1301 N/A INTRINSIC
coiled coil region 1320 1629 N/A INTRINSIC
coiled coil region 1661 2155 N/A INTRINSIC
low complexity region 2193 2208 N/A INTRINSIC
internal_repeat_1 2252 2265 1.95e-5 PROSPERO
low complexity region 2289 2307 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113032
AA Change: L544P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108655
Gene: ENSMUSG00000057110
AA Change: L544P

DomainStartEndE-ValueType
low complexity region 20 53 N/A INTRINSIC
coiled coil region 72 381 N/A INTRINSIC
coiled coil region 413 907 N/A INTRINSIC
low complexity region 945 960 N/A INTRINSIC
coiled coil region 989 1011 N/A INTRINSIC
low complexity region 1041 1059 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113033
SMART Domains Protein: ENSMUSP00000108656
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
coiled coil region 1 247 N/A INTRINSIC
coiled coil region 305 418 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113034
SMART Domains Protein: ENSMUSP00000108657
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
coiled coil region 1 247 N/A INTRINSIC
internal_repeat_3 261 278 5.68e-5 PROSPERO
coiled coil region 305 418 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
coiled coil region 445 549 N/A INTRINSIC
internal_repeat_1 566 579 1.52e-6 PROSPERO
internal_repeat_2 568 596 2.75e-5 PROSPERO
low complexity region 600 608 N/A INTRINSIC
internal_repeat_2 626 653 2.75e-5 PROSPERO
low complexity region 715 748 N/A INTRINSIC
coiled coil region 767 1076 N/A INTRINSIC
internal_repeat_3 1095 1112 5.68e-5 PROSPERO
low complexity region 1184 1224 N/A INTRINSIC
low complexity region 1344 1356 N/A INTRINSIC
low complexity region 1366 1388 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1421 1432 N/A INTRINSIC
low complexity region 1640 1655 N/A INTRINSIC
internal_repeat_1 1699 1712 1.52e-6 PROSPERO
low complexity region 1736 1754 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113037
SMART Domains Protein: ENSMUSP00000108660
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
coiled coil region 1 247 N/A INTRINSIC
internal_repeat_3 261 278 5.34e-5 PROSPERO
coiled coil region 305 548 N/A INTRINSIC
internal_repeat_1 565 578 1.42e-6 PROSPERO
internal_repeat_2 567 595 2.58e-5 PROSPERO
low complexity region 599 607 N/A INTRINSIC
internal_repeat_2 625 652 2.58e-5 PROSPERO
low complexity region 714 747 N/A INTRINSIC
coiled coil region 766 1075 N/A INTRINSIC
internal_repeat_3 1094 1111 5.34e-5 PROSPERO
low complexity region 1183 1223 N/A INTRINSIC
low complexity region 1343 1355 N/A INTRINSIC
low complexity region 1365 1387 N/A INTRINSIC
low complexity region 1399 1414 N/A INTRINSIC
low complexity region 1420 1431 N/A INTRINSIC
low complexity region 1639 1654 N/A INTRINSIC
internal_repeat_1 1698 1711 1.42e-6 PROSPERO
low complexity region 1735 1753 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000123884
AA Change: L144P
SMART Domains Protein: ENSMUSP00000119760
Gene: ENSMUSG00000057110
AA Change: L144P

DomainStartEndE-ValueType
coiled coil region 37 400 N/A INTRINSIC
coiled coil region 458 571 N/A INTRINSIC
low complexity region 576 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150807
SMART Domains Protein: ENSMUSP00000142683
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
coiled coil region 1 140 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156933
AA Change: L544P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118731
Gene: ENSMUSG00000057110
AA Change: L544P

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
LRR 146 167 2.54e1 SMART
LRR 168 190 3.24e0 SMART
LRR 192 214 7.16e0 SMART
Blast:LRR 217 239 7e-6 BLAST
low complexity region 275 292 N/A INTRINSIC
coiled coil region 437 800 N/A INTRINSIC
coiled coil region 858 971 N/A INTRINSIC
low complexity region 975 995 N/A INTRINSIC
coiled coil region 998 1102 N/A INTRINSIC
internal_repeat_1 1119 1132 1.65e-5 PROSPERO
low complexity region 1153 1161 N/A INTRINSIC
low complexity region 1268 1301 N/A INTRINSIC
coiled coil region 1320 1629 N/A INTRINSIC
coiled coil region 1661 2155 N/A INTRINSIC
low complexity region 2193 2208 N/A INTRINSIC
internal_repeat_1 2252 2265 1.65e-5 PROSPERO
low complexity region 2289 2307 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein required for the centrosome to function as a microtubule organizing center. The gene product is also associated with centrosome maturation. One version of stem cell myeloproliferative disorder is the result of a reciprocal translocation between chromosomes 8 and 9, with the breakpoint associated with fibroblast growth factor receptor 1 and centrosomal protein 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit cardiac defects, including double outlet right ventricle, atrial septal defects, ventricular septal defects, tricuspid valve stenosis and heart right ventricle hypoplasia, and develop kidney cysts and hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,683 D441G probably benign Het
4933427D14Rik T C 11: 72,195,754 K277R probably damaging Het
Aatf T C 11: 84,473,100 Y267C probably benign Het
Abi3bp A G 16: 56,594,497 T341A probably damaging Het
Acer2 T C 4: 86,874,586 F33S probably damaging Het
Actr1b A G 1: 36,701,163 V299A possibly damaging Het
Ampd3 T A 7: 110,791,180 probably null Het
Atm A C 9: 53,444,000 I2898R probably damaging Het
Bpifb6 G C 2: 153,906,892 K269N possibly damaging Het
Cacna1c T C 6: 118,598,723 E1927G possibly damaging Het
Cacna1c T A 6: 118,652,714 T1249S probably benign Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Cbll1 A G 12: 31,487,508 V415A probably benign Het
Cd300lf C T 11: 115,124,369 V132I probably benign Het
Chd2 T C 7: 73,463,671 E1187G probably damaging Het
Cryga A C 1: 65,103,010 S75A probably benign Het
Dcbld1 T A 10: 52,319,480 Y261* probably null Het
Ddx11 G A 17: 66,150,729 probably null Het
Dgke C T 11: 89,040,749 V560I probably benign Het
Dst A C 1: 34,228,672 D5065A probably damaging Het
Dusp16 C A 6: 134,720,493 probably null Het
Eif4enif1 T A 11: 3,227,793 V395E probably damaging Het
Enox1 A G 14: 77,577,764 T121A probably damaging Het
Enpp4 G T 17: 44,102,480 N54K probably benign Het
Erc2 A T 14: 28,080,155 K764M probably damaging Het
Ercc6 G T 14: 32,526,403 E304* probably null Het
Fam117a T A 11: 95,364,145 C115S possibly damaging Het
Fcrl5 G A 3: 87,448,324 G448E probably damaging Het
Galntl5 T C 5: 25,186,165 S21P probably benign Het
Garnl3 T C 2: 33,104,880 D39G probably benign Het
Gm14295 C T 2: 176,808,989 Q91* probably null Het
Grb10 T A 11: 11,970,639 probably benign Het
Grip1 C T 10: 120,075,464 Q696* probably null Het
Herc2 T A 7: 56,153,166 C2112* probably null Het
Herc2 T G 7: 56,204,718 L3797R possibly damaging Het
Ighm T C 12: 113,421,567 I258V unknown Het
Jarid2 T A 13: 44,903,063 Y443N possibly damaging Het
Kif13b A G 14: 64,738,634 Y466C probably damaging Het
Krtap4-6 T A 11: 99,665,419 R161* probably null Het
Lingo4 G A 3: 94,403,390 G545E probably benign Het
Lmo2 T G 2: 103,970,601 V39G possibly damaging Het
Lor C A 3: 92,081,812 G56* probably null Het
Lrfn1 A G 7: 28,459,744 R363G probably benign Het
Lrp1b T C 2: 40,657,525 D446G probably benign Het
Ltbp1 G T 17: 75,005,989 G35V possibly damaging Het
Magel2 G A 7: 62,378,679 V444M probably damaging Het
Mkx A T 18: 7,000,591 probably null Het
Ms4a7 A T 19: 11,333,295 I20N possibly damaging Het
Myo5b A G 18: 74,616,991 Y173C probably damaging Het
Nek1 C T 8: 61,072,309 Q594* probably null Het
Nipbl T C 15: 8,300,895 M2349V possibly damaging Het
Nmnat2 A T 1: 153,076,971 H102L probably damaging Het
Nup155 T A 15: 8,153,155 C1201S probably damaging Het
Olfr1249 G A 2: 89,630,631 T89I probably damaging Het
Olfr1373 C A 11: 52,144,596 R311S probably benign Het
Olfr686 G A 7: 105,203,392 T317I probably damaging Het
Osbpl1a A G 18: 12,819,503 probably null Het
Pcnt A G 10: 76,385,798 V1998A probably benign Het
Pitpnc1 T C 11: 107,226,266 H193R probably damaging Het
Pitpnm1 T C 19: 4,110,522 L781P probably damaging Het
Prdm14 A T 1: 13,118,936 C395S probably damaging Het
Prmt8 A G 6: 127,711,804 I201T probably damaging Het
Pter T C 2: 12,978,541 V119A probably damaging Het
Rab11fip4 T C 11: 79,690,829 probably null Het
Rgs9 T C 11: 109,268,987 N173S probably benign Het
Rorb C A 19: 18,977,857 V47L possibly damaging Het
Rtn4r A G 16: 18,151,182 Y158C probably damaging Het
Sdr16c5 C T 4: 4,016,162 G88E probably damaging Het
Sfxn1 C T 13: 54,093,880 T208I probably benign Het
Sgo2b C T 8: 63,927,793 M668I probably benign Het
Slc52a3 G T 2: 152,007,609 probably null Het
Smco1 A T 16: 32,274,014 M168L probably benign Het
Spata31d1d G A 13: 59,728,464 T419I possibly damaging Het
Spink5 T C 18: 44,014,757 S857P probably damaging Het
Stk35 T A 2: 129,810,888 Y436* probably null Het
Tmem225 T A 9: 40,148,435 I37N probably damaging Het
Unkl T C 17: 25,231,865 *232R probably null Het
Usp16 A G 16: 87,483,191 N813S probably benign Het
Vmn1r128 A T 7: 21,350,296 *308C probably null Het
Vmn2r45 A G 7: 8,472,208 V607A probably benign Het
Vmn2r63 A T 7: 42,928,635 probably null Het
Wnk4 A T 11: 101,273,998 N718Y probably damaging Het
Zfp503 G C 14: 21,985,800 Y349* probably null Het
Zfp990 T A 4: 145,538,103 F557Y possibly damaging Het
Other mutations in Cntrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cntrl APN 2 35137814 splice site probably benign
IGL00478:Cntrl APN 2 35160601 missense probably damaging 0.98
IGL01460:Cntrl APN 2 35165844 missense probably benign 0.04
IGL01556:Cntrl APN 2 35173059 missense probably benign 0.19
IGL02155:Cntrl APN 2 35160238 splice site probably benign
IGL02419:Cntrl APN 2 35134043 missense probably damaging 0.97
PIT4480001:Cntrl UTSW 2 35155428 missense probably damaging 0.96
R0179:Cntrl UTSW 2 35167859 missense probably benign 0.00
R0276:Cntrl UTSW 2 35151732 missense possibly damaging 0.62
R0471:Cntrl UTSW 2 35127380 missense probably benign 0.41
R0755:Cntrl UTSW 2 35145139 missense probably damaging 1.00
R0763:Cntrl UTSW 2 35171066 missense probably benign
R0781:Cntrl UTSW 2 35160627 missense possibly damaging 0.66
R0791:Cntrl UTSW 2 35155279 missense possibly damaging 0.83
R0792:Cntrl UTSW 2 35155279 missense possibly damaging 0.83
R0801:Cntrl UTSW 2 35175095 splice site probably benign
R1067:Cntrl UTSW 2 35149022 unclassified probably benign
R1110:Cntrl UTSW 2 35160627 missense possibly damaging 0.66
R1117:Cntrl UTSW 2 35127973 missense probably damaging 1.00
R1457:Cntrl UTSW 2 35122756 missense probably benign 0.00
R1472:Cntrl UTSW 2 35169317 critical splice donor site probably null
R1522:Cntrl UTSW 2 35155279 missense possibly damaging 0.83
R1702:Cntrl UTSW 2 35171836 critical splice acceptor site probably null
R1762:Cntrl UTSW 2 35122806 frame shift probably null
R1785:Cntrl UTSW 2 35122806 frame shift probably null
R1786:Cntrl UTSW 2 35122806 frame shift probably null
R1812:Cntrl UTSW 2 35149469 missense probably damaging 0.97
R1854:Cntrl UTSW 2 35122684 missense probably damaging 1.00
R1863:Cntrl UTSW 2 35118119 missense possibly damaging 0.93
R1868:Cntrl UTSW 2 35129815 missense probably benign 0.03
R1914:Cntrl UTSW 2 35162861 missense probably benign 0.00
R1915:Cntrl UTSW 2 35162861 missense probably benign 0.00
R2049:Cntrl UTSW 2 35122806 frame shift probably null
R2118:Cntrl UTSW 2 35161965 missense probably benign 0.31
R2140:Cntrl UTSW 2 35122806 frame shift probably null
R2142:Cntrl UTSW 2 35122806 frame shift probably null
R2203:Cntrl UTSW 2 35143737 missense possibly damaging 0.84
R2300:Cntrl UTSW 2 35127513 missense probably benign 0.00
R2349:Cntrl UTSW 2 35176251 missense probably benign 0.18
R2374:Cntrl UTSW 2 35153276 missense possibly damaging 0.46
R3429:Cntrl UTSW 2 35145100 missense probably damaging 1.00
R3890:Cntrl UTSW 2 35170480 missense probably benign 0.02
R3911:Cntrl UTSW 2 35120049 missense probably damaging 1.00
R3922:Cntrl UTSW 2 35129739 missense probably damaging 0.98
R4081:Cntrl UTSW 2 35161926 splice site probably benign
R4081:Cntrl UTSW 2 35175125 missense probably damaging 1.00
R4516:Cntrl UTSW 2 35127981 missense probably benign 0.00
R4518:Cntrl UTSW 2 35148974 missense probably damaging 1.00
R4519:Cntrl UTSW 2 35173111 missense probably damaging 1.00
R4646:Cntrl UTSW 2 35149461 missense probably damaging 0.99
R4753:Cntrl UTSW 2 35153439 missense possibly damaging 0.90
R4763:Cntrl UTSW 2 35175551 missense probably damaging 1.00
R4916:Cntrl UTSW 2 35165682 missense probably benign 0.42
R5168:Cntrl UTSW 2 35157655 missense probably damaging 1.00
R5291:Cntrl UTSW 2 35134060 missense probably damaging 1.00
R5356:Cntrl UTSW 2 35148899 nonsense probably null
R5774:Cntrl UTSW 2 35162861 missense probably benign 0.15
R5947:Cntrl UTSW 2 35116679 missense probably damaging 1.00
R6144:Cntrl UTSW 2 35165733 missense possibly damaging 0.93
R6147:Cntrl UTSW 2 35165733 missense possibly damaging 0.93
R6214:Cntrl UTSW 2 35129634 missense probably benign 0.10
R6332:Cntrl UTSW 2 35128024 missense possibly damaging 0.78
R6445:Cntrl UTSW 2 35162848 missense probably benign 0.05
R6487:Cntrl UTSW 2 35122682 missense possibly damaging 0.89
R6497:Cntrl UTSW 2 35135572 missense possibly damaging 0.66
R6782:Cntrl UTSW 2 35170646 missense possibly damaging 0.75
R6815:Cntrl UTSW 2 35149491 missense probably damaging 1.00
R6853:Cntrl UTSW 2 35129821 missense possibly damaging 0.87
R6858:Cntrl UTSW 2 35162095 critical splice donor site probably null
R6965:Cntrl UTSW 2 35162833 missense probably benign 0.20
R6970:Cntrl UTSW 2 35118137 missense probably benign
R7085:Cntrl UTSW 2 35165792 missense probably benign 0.00
R7150:Cntrl UTSW 2 35165445 critical splice acceptor site probably null
R7213:Cntrl UTSW 2 35135680 missense possibly damaging 0.95
R7221:Cntrl UTSW 2 35151857 missense possibly damaging 0.46
R7389:Cntrl UTSW 2 35127517 missense probably benign 0.01
R7414:Cntrl UTSW 2 35165467 missense probably benign 0.02
R7427:Cntrl UTSW 2 35170534 missense probably benign 0.00
R7428:Cntrl UTSW 2 35170534 missense probably benign 0.00
R7453:Cntrl UTSW 2 35155409 missense possibly damaging 0.89
R7747:Cntrl UTSW 2 35116798 missense probably damaging 1.00
R7753:Cntrl UTSW 2 35111679 missense probably damaging 1.00
R7811:Cntrl UTSW 2 35162861 missense probably benign 0.00
R7882:Cntrl UTSW 2 35170580 missense probably benign 0.41
R7919:Cntrl UTSW 2 35127401 missense probably benign
R8314:Cntrl UTSW 2 35175143 missense probably benign 0.00
R8332:Cntrl UTSW 2 35126025 missense probably damaging 1.00
RF007:Cntrl UTSW 2 35170500 missense probably benign
RF016:Cntrl UTSW 2 35119986 missense probably benign
RF017:Cntrl UTSW 2 35175189 missense probably damaging 0.96
X0024:Cntrl UTSW 2 35147296 missense probably damaging 1.00
X0026:Cntrl UTSW 2 35149516 missense probably damaging 1.00
X0027:Cntrl UTSW 2 35157768 missense probably damaging 1.00
X0027:Cntrl UTSW 2 35165682 missense probably benign 0.08
X0028:Cntrl UTSW 2 35147344 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ATTTCAGAAGCAGAGAAAGACCTC -3'
(R):5'- CAAGACTAGGTGGTTCCATTTTGG -3'

Sequencing Primer
(F):5'- GAAAGACCTCCTTCTCAAGCAGTTG -3'
(R):5'- GTGGTTCCATTTTGGATATAAATGTT -3'
Posted On2018-03-15