Mutagenetix > Incidental Mutation

Incidental Mutation 'R7085:Smchd1'

568536

Institutional Source

Beutler Lab

Gene Symbol

Smchd1

Ensembl Gene

ENSMUSG00000024054

Gene Name

SMC hinge domain containing 1

Synonyms

4931400A14Rik, MommeD1

MMRRC Submission

045179-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.842) question?

Stock #

R7085 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71344489-71475343 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 71365219 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000121835 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000127430]

AlphaFold

Q6P5D8

Predicted Effect

probably null
Transcript: ENSMUST00000127430

SMART Domains

Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054

Domain	Start	End	E-Value	Type
Pfam:HATPase_c_3	139	299	6.8e-16	PFAM
low complexity region	451	457	N/A	INTRINSIC
internal_repeat_1	859	1087	9.1e-5	PROSPERO
low complexity region	1185	1196	N/A	INTRINSIC
internal_repeat_1	1205	1409	9.1e-5	PROSPERO
coiled coil region	1649	1680	N/A	INTRINSIC
SMC_hinge	1721	1848	1.64e-15	SMART
low complexity region	1940	1954	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

95% (75/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	A	G	1: 26,683,465	L878P	possibly damaging	Het
9330159F19Rik	T	C	10: 29,224,480	L283P	probably damaging	Het
Abhd18	T	C	3: 40,916,909	M132T	possibly damaging	Het
Afap1l1	A	G	18: 61,748,814	V270A	possibly damaging	Het
Ankrd34a	A	T	3: 96,598,629	Q383L	probably benign	Het
Atp8b5	A	G	4: 43,361,835	D627G	probably damaging	Het
Atrnl1	T	A	19: 57,691,857	C730S	probably damaging	Het
Bclaf1	T	C	10: 20,322,022	S4P	unknown	Het
Blzf1	T	C	1: 164,302,324	D153G	probably damaging	Het
Btaf1	T	C	19: 36,972,918	V516A	probably benign	Het
C1qa	T	C	4: 136,897,780	T20A	probably benign	Het
Cacna1e	A	T	1: 154,473,746		probably null	Het
Cfd	T	G	10: 79,892,492	V229G	probably damaging	Het
Chd3	T	A	11: 69,369,201	H64L	unknown	Het
Cntn3	A	G	6: 102,165,401	S1002P	possibly damaging	Het
Cntrl	T	A	2: 35,165,792	C1786S	probably benign	Het
Cpa1	A	G	6: 30,643,620	D355G	probably benign	Het
D130043K22Rik	T	C	13: 24,872,302	V539A	possibly damaging	Het
Ddx1	A	C	12: 13,229,355	W428G	probably damaging	Het
Ddx49	G	A	8: 70,302,483		probably benign	Het
Dnhd1	T	A	7: 105,715,261	V4207E	probably benign	Het
Dock3	A	G	9: 106,901,887	S288P	probably damaging	Het
Drap1	G	A	19: 5,424,787		probably benign	Het
Ecm2	G	A	13: 49,520,902	R266K	probably damaging	Het
Emilin2	A	G	17: 71,274,105	L542S	probably damaging	Het
Evx1	T	C	6: 52,316,692	Y282H	possibly damaging	Het
Fam159b	G	T	13: 104,858,306	T111K	probably benign	Het
Fbxo44	T	A	4: 148,158,743	H20L	probably damaging	Het
Flot2	G	T	11: 78,058,074	A292S	possibly damaging	Het
Fry	A	G	5: 150,438,749	I2161V	probably benign	Het
Gli3	T	C	13: 15,715,062	F587S	probably damaging	Het
Gm10697	T	A	3: 94,072,632	M5L	probably benign	Het
Gm4450	T	C	3: 98,450,394	N101D	probably damaging	Het
Gm49368	A	G	7: 128,126,857	D1147G	unknown	Het
Gm6970	A	G	19: 47,170,662	V158A	unknown	Het
Gprc5b	A	T	7: 118,983,632	M338K	probably damaging	Het
Hacd3	A	C	9: 64,998,243	N204K	probably damaging	Het
Hydin	A	G	8: 110,603,330	T4899A	probably benign	Het
Ido2	T	A	8: 24,558,196	R49S	probably benign	Het
Igsf3	C	A	3: 101,455,489	T942K	probably benign	Het
Kank4	T	A	4: 98,779,946	Q88L	probably benign	Het
Krtap16-1	T	A	11: 99,986,285	I98F	possibly damaging	Het
Laptm4a	T	C	12: 8,922,113	V52A	probably benign	Het
Lmbr1	A	T	5: 29,361,092		probably null	Het
Lnx1	G	A	5: 74,628,185	S31F	possibly damaging	Het
Mafa	G	T	15: 75,747,687	A79E	unknown	Het
Me2	A	T	18: 73,781,058	N467K	probably damaging	Het
Med23	T	A	10: 24,870,121	L8Q	probably damaging	Het
Muc16	T	A	9: 18,644,849	I3383F	unknown	Het
Nbas	G	T	12: 13,285,258	S151I	probably damaging	Het
Olfr1130	T	A	2: 87,607,406	I6N	probably benign	Het
Olfr231	T	A	1: 174,117,660	I119F	probably damaging	Het
Olfr272	C	T	4: 52,910,961	A278T	probably benign	Het
Olfr867	G	A	9: 20,054,936	H58Y	probably benign	Het
Olfr976	C	A	9: 39,956,512	C141F	probably damaging	Het
Piezo1	A	G	8: 122,490,894	V1305A		Het
Plcb3	T	C	19: 6,960,133	E639G	possibly damaging	Het
Polr2a	A	G	11: 69,743,880	L658P	probably damaging	Het
Prag1	A	T	8: 36,104,237	Q658L	possibly damaging	Het
Prex2	A	T	1: 11,098,588	R269S	possibly damaging	Het
Reln	C	A	5: 21,915,087	G2856*	probably null	Het
Rsph10b	A	T	5: 143,949,284	T267S	possibly damaging	Het
Rtn4rl1	A	G	11: 75,265,224	I161V	probably benign	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Sbno1	G	A	5: 124,381,720	P1165L	possibly damaging	Het
Scn3b	T	C	9: 40,277,098	V29A	probably damaging	Het
Sh3d21	T	A	4: 126,163,091	T13S	probably benign	Het
Slc22a22	G	A	15: 57,249,649	T398I	probably benign	Het
Slc40a1	T	A	1: 45,911,528	T255S	probably benign	Het
Soat1	A	T	1: 156,432,331	V480D	probably damaging	Het
Supt5	T	A	7: 28,331,489	E39V	unknown	Het
Tapbpl	T	C	6: 125,226,488		probably null	Het
Tlr11	A	T	14: 50,362,656	I700F	probably damaging	Het
Tmc3	A	T	7: 83,622,145	K864M	possibly damaging	Het
Tns1	G	A	1: 73,925,462	P81S	probably benign	Het
Tspan2	C	A	3: 102,760,954	L168I	probably benign	Het
Unc13d	C	A	11: 116,064,807	S885I	probably benign	Het
Unc45a	A	T	7: 80,326,334	M799K	possibly damaging	Het
Usp34	A	G	11: 23,363,097	D547G		Het
Vps33b	A	G	7: 80,276,089	I95V	probably benign	Het

Other mutations in Smchd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Smchd1	APN	17	71465673	splice site	probably benign
IGL00529:Smchd1	APN	17	71394799	missense	probably benign	0.30
IGL00642:Smchd1	APN	17	71390432	missense	probably damaging	1.00
IGL00821:Smchd1	APN	17	71398623	missense	possibly damaging	0.92
IGL01330:Smchd1	APN	17	71436788	missense	probably benign
IGL01432:Smchd1	APN	17	71431290	missense	probably damaging	1.00
IGL01473:Smchd1	APN	17	71389750	missense	probably benign	0.00
IGL01705:Smchd1	APN	17	71381398	missense	probably damaging	1.00
IGL01787:Smchd1	APN	17	71391418	missense	probably damaging	0.99
IGL01814:Smchd1	APN	17	71378187	missense	probably benign	0.01
IGL01976:Smchd1	APN	17	71394725	nonsense	probably null
IGL01995:Smchd1	APN	17	71444020	missense	probably damaging	0.98
IGL02090:Smchd1	APN	17	71431253	missense	possibly damaging	0.86
IGL02302:Smchd1	APN	17	71358133	splice site	probably benign
IGL02309:Smchd1	APN	17	71443903	missense	probably benign	0.32
IGL02391:Smchd1	APN	17	71431259	missense	probably null	1.00
IGL02515:Smchd1	APN	17	71440957	missense	probably damaging	1.00
IGL02644:Smchd1	APN	17	71360021	splice site	probably benign
IGL03081:Smchd1	APN	17	71360191	missense	probably damaging	0.98
IGL03212:Smchd1	APN	17	71443891	missense	probably damaging	0.99
IGL03236:Smchd1	APN	17	71391430	missense	possibly damaging	0.88
IGL03297:Smchd1	APN	17	71349700	missense	probably benign	0.01
Dry_tortugas	UTSW	17	71440956	missense	probably damaging	1.00
R0049:Smchd1	UTSW	17	71431236	missense	probably benign	0.01
R0254:Smchd1	UTSW	17	71411891	missense	probably benign	0.00
R0391:Smchd1	UTSW	17	71403154	missense	probably damaging	1.00
R0403:Smchd1	UTSW	17	71394902	missense	probably damaging	1.00
R0499:Smchd1	UTSW	17	71387088	missense	probably benign
R0520:Smchd1	UTSW	17	71429543	missense	possibly damaging	0.85
R0616:Smchd1	UTSW	17	71379574	missense	probably benign	0.39
R1120:Smchd1	UTSW	17	71358146	nonsense	probably null
R1469:Smchd1	UTSW	17	71349730	missense	probably damaging	1.00
R1469:Smchd1	UTSW	17	71349730	missense	probably damaging	1.00
R1473:Smchd1	UTSW	17	71361837	splice site	probably benign
R1484:Smchd1	UTSW	17	71378257	missense	probably benign	0.31
R1501:Smchd1	UTSW	17	71365094	missense	possibly damaging	0.54
R1718:Smchd1	UTSW	17	71448833	missense	possibly damaging	0.46
R1765:Smchd1	UTSW	17	71400201	splice site	probably benign
R1766:Smchd1	UTSW	17	71391379	missense	probably damaging	0.99
R1803:Smchd1	UTSW	17	71387006	missense	probably damaging	0.99
R1829:Smchd1	UTSW	17	71370337	missense	probably damaging	1.00
R1850:Smchd1	UTSW	17	71389771	missense	probably damaging	0.99
R1917:Smchd1	UTSW	17	71407237	missense	possibly damaging	0.48
R1918:Smchd1	UTSW	17	71407237	missense	possibly damaging	0.48
R1936:Smchd1	UTSW	17	71463791	missense	probably damaging	1.00
R2024:Smchd1	UTSW	17	71370928	missense	probably benign	0.15
R2147:Smchd1	UTSW	17	71398588	missense	possibly damaging	0.93
R2180:Smchd1	UTSW	17	71463799	missense	probably benign	0.23
R2398:Smchd1	UTSW	17	71360141	missense	probably damaging	1.00
R2398:Smchd1	UTSW	17	71426436	splice site	probably benign
R2935:Smchd1	UTSW	17	71411905	missense	probably damaging	1.00
R3000:Smchd1	UTSW	17	71363038	missense	probably benign	0.00
R3021:Smchd1	UTSW	17	71387098	missense	possibly damaging	0.75
R3808:Smchd1	UTSW	17	71429541	missense	probably damaging	1.00
R4323:Smchd1	UTSW	17	71428275	missense	probably benign	0.00
R4486:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4487:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4488:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4489:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4723:Smchd1	UTSW	17	71436747	nonsense	probably null
R4751:Smchd1	UTSW	17	71391468	missense	probably benign	0.01
R4798:Smchd1	UTSW	17	71360053	nonsense	probably null
R4814:Smchd1	UTSW	17	71411768	critical splice donor site	probably null
R4882:Smchd1	UTSW	17	71358239	intron	probably benign
R5088:Smchd1	UTSW	17	71431348	missense	possibly damaging	0.86
R5589:Smchd1	UTSW	17	71440961	missense	probably damaging	1.00
R5618:Smchd1	UTSW	17	71455727	missense	probably damaging	1.00
R5839:Smchd1	UTSW	17	71394862	missense	probably damaging	0.98
R5994:Smchd1	UTSW	17	71365409	missense	possibly damaging	0.89
R6009:Smchd1	UTSW	17	71440956	missense	probably damaging	1.00
R6042:Smchd1	UTSW	17	71377057	nonsense	probably null
R6082:Smchd1	UTSW	17	71349719	missense	probably benign	0.09
R6126:Smchd1	UTSW	17	71370285	missense	probably damaging	1.00
R6294:Smchd1	UTSW	17	71370927	missense	probably benign	0.13
R6788:Smchd1	UTSW	17	71475101	missense	probably benign	0.02
R6853:Smchd1	UTSW	17	71436743	missense	probably damaging	1.00
R6875:Smchd1	UTSW	17	71353506	missense	probably damaging	1.00
R7026:Smchd1	UTSW	17	71349667	missense	probably benign
R7045:Smchd1	UTSW	17	71415044	missense	probably benign	0.22
R7068:Smchd1	UTSW	17	71387092	missense	probably benign	0.00
R7089:Smchd1	UTSW	17	71361960	missense	probably benign	0.00
R7145:Smchd1	UTSW	17	71378207	missense	probably benign
R7158:Smchd1	UTSW	17	71400150	missense	probably damaging	0.99
R7180:Smchd1	UTSW	17	71394823	missense	probably damaging	0.99
R7183:Smchd1	UTSW	17	71353516	missense	probably benign	0.00
R7214:Smchd1	UTSW	17	71345364	missense	probably benign	0.15
R7414:Smchd1	UTSW	17	71475079	missense	probably damaging	0.99
R7512:Smchd1	UTSW	17	71381369	missense	possibly damaging	0.51
R7631:Smchd1	UTSW	17	71398689	missense	probably benign	0.10
R7641:Smchd1	UTSW	17	71390479	missense	probably benign	0.00
R7709:Smchd1	UTSW	17	71358198	missense	probably damaging	1.00
R7768:Smchd1	UTSW	17	71411911	missense	probably damaging	1.00
R7789:Smchd1	UTSW	17	71475301	start gained	probably benign
R7898:Smchd1	UTSW	17	71377818	splice site	probably null
R7965:Smchd1	UTSW	17	71455626	missense	possibly damaging	0.65
R8177:Smchd1	UTSW	17	71390453	missense	probably benign	0.28
R8359:Smchd1	UTSW	17	71431243	missense	probably damaging	0.99
R8370:Smchd1	UTSW	17	71394913	missense	probably benign	0.22
R8426:Smchd1	UTSW	17	71448603	missense	probably damaging	1.00
R8443:Smchd1	UTSW	17	71407249	missense	probably benign	0.18
R8948:Smchd1	UTSW	17	71436772	missense	probably damaging	1.00
R8954:Smchd1	UTSW	17	71448757	missense	probably damaging	1.00
R9041:Smchd1	UTSW	17	71394715	critical splice donor site	probably null
R9054:Smchd1	UTSW	17	71363022	nonsense	probably null
R9141:Smchd1	UTSW	17	71365130	missense	probably benign	0.00
R9169:Smchd1	UTSW	17	71415664	missense	probably damaging	1.00
R9231:Smchd1	UTSW	17	71365089	missense	probably benign	0.05
R9368:Smchd1	UTSW	17	71387076	missense	probably damaging	1.00
R9374:Smchd1	UTSW	17	71411848	missense	possibly damaging	0.61
R9416:Smchd1	UTSW	17	71394796	missense	probably benign	0.27
R9426:Smchd1	UTSW	17	71365130	missense	probably benign	0.00
R9491:Smchd1	UTSW	17	71360025	critical splice donor site	probably null
R9511:Smchd1	UTSW	17	71443904	missense	possibly damaging	0.65
R9591:Smchd1	UTSW	17	71394833	missense	probably damaging	1.00
R9593:Smchd1	UTSW	17	71394833	missense	probably damaging	1.00
Z1176:Smchd1	UTSW	17	71361841	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- AGAAAGCAGTCAGGTGGTCC -3'
(R):5'- CTCGGCTGTCAACTGTATCAG -3'

Sequencing Primer
(F):5'- GCCTCGCCACTCCTCATAG -3'
(R):5'- GCTGTCAACTGTATCAGGAACATTAG -3'

Posted On

2019-08-16