Incidental Mutation 'R7095:Olfr589'
ID550421
Institutional Source Beutler Lab
Gene Symbol Olfr589
Ensembl Gene ENSMUSG00000051362
Gene Nameolfactory receptor 589
SynonymsMOR32-3, GA_x6K02T2PBJ9-5871256-5870303
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7095 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103154792-103156356 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103155330 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 139 (T139I)
Ref Sequence ENSEMBL: ENSMUSP00000151739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061055] [ENSMUST00000218483]
Predicted Effect probably damaging
Transcript: ENSMUST00000061055
AA Change: T139I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060166
Gene: ENSMUSG00000051362
AA Change: T139I

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 3.1e-132 PFAM
Pfam:7TM_GPCR_Srsx 37 171 1.5e-7 PFAM
Pfam:7tm_1 43 293 1.1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218483
AA Change: T139I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6485 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A G 17: 35,957,511 V809A possibly damaging Het
Adam32 T A 8: 24,914,070 D242V probably damaging Het
Adamts9 T A 6: 92,887,691 H763L probably benign Het
Aff1 A G 5: 103,843,085 D967G probably damaging Het
Anpep A T 7: 79,842,202 L17Q possibly damaging Het
Appbp2 G T 11: 85,234,727 S28* probably null Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Bod1l A G 5: 41,795,068 probably null Het
Capn5 G A 7: 98,125,831 T534I probably benign Het
Cbx2 T C 11: 119,028,059 I150T probably damaging Het
Cdh11 A G 8: 102,658,267 V392A probably damaging Het
Cenpf A T 1: 189,659,176 C803S probably benign Het
Cep135 A G 5: 76,594,058 T114A probably benign Het
Chd2 A T 7: 73,471,881 D994E probably damaging Het
Chtf18 C A 17: 25,722,678 W584C probably damaging Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
Dgkh C A 14: 78,627,784 M172I probably benign Het
Dpy19l2 T G 9: 24,695,814 H117P probably benign Het
Dzip3 A T 16: 48,927,790 N908K probably benign Het
Erc2 A T 14: 27,898,593 N393Y probably damaging Het
Fam118b T C 9: 35,221,490 E291G possibly damaging Het
Fam193a C T 5: 34,458,034 L816F probably damaging Het
Fat2 A G 11: 55,311,331 Y306H probably damaging Het
Fndc10 C T 4: 155,695,117 T206I probably damaging Het
Fzd1 GGGACTCCTCCACCTCCCTGGA GGGA 5: 4,755,824 probably benign Het
Gsk3a A T 7: 25,233,854 Y177N probably damaging Het
Haus5 T C 7: 30,659,572 T222A probably benign Het
Igfbp7 G T 5: 77,401,490 Q189K probably benign Het
Inppl1 A T 7: 101,827,456 Y771* probably null Het
Iqck A T 7: 118,915,591 Y234F probably damaging Het
Irs1 G T 1: 82,290,098 C132* probably null Het
Jmjd1c T G 10: 67,219,632 V277G probably benign Het
Klhl22 G A 16: 17,792,750 V622M probably damaging Het
Kri1 C T 9: 21,279,432 E378K Het
Lilra6 C T 7: 3,913,197 G221D probably damaging Het
Marc1 A G 1: 184,795,240 L297P probably damaging Het
Mecom T C 3: 29,980,954 E191G probably damaging Het
Mgrn1 T A 16: 4,927,664 probably null Het
Mical1 C T 10: 41,479,210 probably null Het
Mlxipl T C 5: 135,134,030 Y711H possibly damaging Het
Mpl T A 4: 118,444,063 H535L Het
Mtfr2 C A 10: 20,352,920 H71N probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh15 A G 16: 49,171,909 Q1582R possibly damaging Het
Neb C T 2: 52,177,623 E6062K possibly damaging Het
Nlrp4c G A 7: 6,060,793 A67T probably damaging Het
Noc3l T A 19: 38,812,345 H231L probably benign Het
Odf1 T C 15: 38,219,559 Y44H possibly damaging Het
Olfr1052 C T 2: 86,298,677 P287L probably benign Het
Olfr591 C T 7: 103,173,046 R197H probably benign Het
Otol1 G T 3: 70,018,694 E67D probably benign Het
Otud7b A G 3: 96,155,237 S598G probably benign Het
Ppwd1 T A 13: 104,205,626 T607S probably benign Het
Prag1 A G 8: 36,102,560 N99S probably benign Het
Ralgds C A 2: 28,549,308 Q737K possibly damaging Het
Scyl2 T C 10: 89,669,687 H98R probably damaging Het
Secisbp2 A C 13: 51,677,254 Q575H probably benign Het
Slc9a5 A T 8: 105,357,636 H497L probably benign Het
Sufu T A 19: 46,475,588 V414E probably damaging Het
Tbc1d22b A T 17: 29,599,869 E399V probably damaging Het
Tcp10c G A 17: 13,355,934 V59I probably benign Het
Tdpoz3 T C 3: 93,827,061 S348P probably benign Het
Tmem219 A T 7: 126,891,756 F176L probably damaging Het
Trav6-2 A G 14: 52,667,834 D104G probably damaging Het
Uba7 A G 9: 107,983,339 K927R probably benign Het
Vps54 T G 11: 21,271,720 D158E probably benign Het
Xpnpep1 C T 19: 53,011,765 probably null Het
Xpo7 G A 14: 70,704,706 R73W probably damaging Het
Zfp532 A T 18: 65,682,898 M781L probably benign Het
Zfp930 T A 8: 69,228,541 I295K probably benign Het
Other mutations in Olfr589
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01955:Olfr589 APN 7 103154854 nonsense probably null
IGL02059:Olfr589 APN 7 103155103 missense probably benign 0.14
IGL02336:Olfr589 APN 7 103155565 missense probably benign 0.09
IGL03355:Olfr589 APN 7 103155201 missense probably damaging 1.00
PIT4508001:Olfr589 UTSW 7 103155313 missense probably benign
R0900:Olfr589 UTSW 7 103155313 missense probably benign
R2250:Olfr589 UTSW 7 103154950 missense probably damaging 1.00
R3500:Olfr589 UTSW 7 103155090 missense probably damaging 1.00
R4756:Olfr589 UTSW 7 103155125 missense probably benign 0.24
R4776:Olfr589 UTSW 7 103155414 missense probably benign 0.40
R5022:Olfr589 UTSW 7 103155735 missense probably benign
R5151:Olfr589 UTSW 7 103155386 missense probably damaging 0.99
R5231:Olfr589 UTSW 7 103154968 missense probably damaging 1.00
R5870:Olfr589 UTSW 7 103155741 missense probably benign 0.00
R5973:Olfr589 UTSW 7 103154874 missense possibly damaging 0.93
R6567:Olfr589 UTSW 7 103154928 missense possibly damaging 0.94
R8214:Olfr589 UTSW 7 103155406 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTGGCCTTGACACTTGC -3'
(R):5'- TGGCTATGTTGGCTACCATTGAC -3'

Sequencing Primer
(F):5'- ATTGGCCTTGACACTTGCACAAG -3'
(R):5'- ATTGACTTGGGCCTCTCAACAG -3'
Posted On2019-05-15