Mutagenetix > Incidental Mutations

Incidental Mutation 'R7095:Cep135'

550408

Institutional Source

Beutler Lab

Gene Symbol

Cep135

Ensembl Gene

ENSMUSG00000036403

Gene Name

centrosomal protein 135

Synonyms

LOC381644, Cep4

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7095 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76588698-76646466 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 76594058 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 114 (T114A)

Ref Sequence

ENSEMBL: ENSMUSP00000038674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049060] [ENSMUST00000121979]

Predicted Effect

probably benign
Transcript: ENSMUST00000049060
AA Change: T114A

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000038674
Gene: ENSMUSG00000036403
AA Change: T114A

Domain	Start	End	E-Value	Type
internal_repeat_1	47	71	1.87e-5	PROSPERO
low complexity region	78	92	N/A	INTRINSIC
internal_repeat_1	100	124	1.87e-5	PROSPERO
coiled coil region	125	153	N/A	INTRINSIC
coiled coil region	194	245	N/A	INTRINSIC
coiled coil region	267	420	N/A	INTRINSIC
coiled coil region	445	470	N/A	INTRINSIC
Blast:HAMP	492	527	5e-11	BLAST
Blast:SPEC	760	863	6e-21	BLAST
low complexity region	1060	1072	N/A	INTRINSIC
coiled coil region	1075	1117	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121979
AA Change: T114A

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000112602
Gene: ENSMUSG00000036403
AA Change: T114A

Domain	Start	End	E-Value	Type
internal_repeat_1	47	71	1.87e-5	PROSPERO
low complexity region	78	92	N/A	INTRINSIC
internal_repeat_1	100	124	1.87e-5	PROSPERO
coiled coil region	125	153	N/A	INTRINSIC
coiled coil region	194	245	N/A	INTRINSIC
coiled coil region	267	420	N/A	INTRINSIC
coiled coil region	445	470	N/A	INTRINSIC
Blast:HAMP	492	527	5e-11	BLAST
Blast:SPEC	760	863	6e-21	BLAST
low complexity region	1060	1072	N/A	INTRINSIC
coiled coil region	1075	1117	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein, which acts as a scaffolding protein during early centriole biogenesis, and is also required for centriole-centriole cohesion during interphase. Mutations in this gene are associated with autosomal recessive primary microcephaly-8. [provided by RefSeq, Jun 2012]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcf1	A	G	17: 35,957,511	V809A	possibly damaging	Het
Adam32	T	A	8: 24,914,070	D242V	probably damaging	Het
Adamts9	T	A	6: 92,887,691	H763L	probably benign	Het
Aff1	A	G	5: 103,843,085	D967G	probably damaging	Het
Anpep	A	T	7: 79,842,202	L17Q	possibly damaging	Het
Appbp2	G	T	11: 85,234,727	S28*	probably null	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Bod1l	A	G	5: 41,795,068		probably null	Het
Capn5	G	A	7: 98,125,831	T534I	probably benign	Het
Cbx2	T	C	11: 119,028,059	I150T	probably damaging	Het
Cdh11	A	G	8: 102,658,267	V392A	probably damaging	Het
Cenpf	A	T	1: 189,659,176	C803S	probably benign	Het
Chd2	A	T	7: 73,471,881	D994E	probably damaging	Het
Chtf18	C	A	17: 25,722,678	W584C	probably damaging	Het
Dclk2	C	T	3: 86,793,259	R638H	probably damaging	Het
Dgkh	C	A	14: 78,627,784	M172I	probably benign	Het
Dpy19l2	T	G	9: 24,695,814	H117P	probably benign	Het
Dzip3	A	T	16: 48,927,790	N908K	probably benign	Het
Erc2	A	T	14: 27,898,593	N393Y	probably damaging	Het
Fam118b	T	C	9: 35,221,490	E291G	possibly damaging	Het
Fam193a	C	T	5: 34,458,034	L816F	probably damaging	Het
Fat2	A	G	11: 55,311,331	Y306H	probably damaging	Het
Fndc10	C	T	4: 155,695,117	T206I	probably damaging	Het
Fzd1	GGGACTCCTCCACCTCCCTGGA	GGGA	5: 4,755,824		probably benign	Het
Gsk3a	A	T	7: 25,233,854	Y177N	probably damaging	Het
Haus5	T	C	7: 30,659,572	T222A	probably benign	Het
Igfbp7	G	T	5: 77,401,490	Q189K	probably benign	Het
Inppl1	A	T	7: 101,827,456	Y771*	probably null	Het
Iqck	A	T	7: 118,915,591	Y234F	probably damaging	Het
Irs1	G	T	1: 82,290,098	C132*	probably null	Het
Jmjd1c	T	G	10: 67,219,632	V277G	probably benign	Het
Klhl22	G	A	16: 17,792,750	V622M	probably damaging	Het
Kri1	C	T	9: 21,279,432	E378K		Het
Lilra6	C	T	7: 3,913,197	G221D	probably damaging	Het
Marc1	A	G	1: 184,795,240	L297P	probably damaging	Het
Mecom	T	C	3: 29,980,954	E191G	probably damaging	Het
Mgrn1	T	A	16: 4,927,664		probably null	Het
Mical1	C	T	10: 41,479,210		probably null	Het
Mlxipl	T	C	5: 135,134,030	Y711H	possibly damaging	Het
Mpl	T	A	4: 118,444,063	H535L		Het
Mtfr2	C	A	10: 20,352,920	H71N	probably benign	Het
Mtrf1	GCCTTC	GC	14: 79,423,491		probably null	Het
Myh15	A	G	16: 49,171,909	Q1582R	possibly damaging	Het
Neb	C	T	2: 52,177,623	E6062K	possibly damaging	Het
Nlrp4c	G	A	7: 6,060,793	A67T	probably damaging	Het
Noc3l	T	A	19: 38,812,345	H231L	probably benign	Het
Odf1	T	C	15: 38,219,559	Y44H	possibly damaging	Het
Olfr1052	C	T	2: 86,298,677	P287L	probably benign	Het
Olfr589	G	A	7: 103,155,330	T139I	probably damaging	Het
Olfr591	C	T	7: 103,173,046	R197H	probably benign	Het
Otol1	G	T	3: 70,018,694	E67D	probably benign	Het
Otud7b	A	G	3: 96,155,237	S598G	probably benign	Het
Ppwd1	T	A	13: 104,205,626	T607S	probably benign	Het
Prag1	A	G	8: 36,102,560	N99S	probably benign	Het
Ralgds	C	A	2: 28,549,308	Q737K	possibly damaging	Het
Scyl2	T	C	10: 89,669,687	H98R	probably damaging	Het
Secisbp2	A	C	13: 51,677,254	Q575H	probably benign	Het
Slc9a5	A	T	8: 105,357,636	H497L	probably benign	Het
Sufu	T	A	19: 46,475,588	V414E	probably damaging	Het
Tbc1d22b	A	T	17: 29,599,869	E399V	probably damaging	Het
Tcp10c	G	A	17: 13,355,934	V59I	probably benign	Het
Tdpoz3	T	C	3: 93,827,061	S348P	probably benign	Het
Tmem219	A	T	7: 126,891,756	F176L	probably damaging	Het
Trav6-2	A	G	14: 52,667,834	D104G	probably damaging	Het
Uba7	A	G	9: 107,983,339	K927R	probably benign	Het
Vps54	T	G	11: 21,271,720	D158E	probably benign	Het
Xpnpep1	C	T	19: 53,011,765		probably null	Het
Xpo7	G	A	14: 70,704,706	R73W	probably damaging	Het
Zfp532	A	T	18: 65,682,898	M781L	probably benign	Het
Zfp930	T	A	8: 69,228,541	I295K	probably benign	Het

Other mutations in Cep135

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Cep135	APN	5	76601459	missense	probably damaging	0.98
IGL01154:Cep135	APN	5	76606796	splice site	probably benign
IGL01323:Cep135	APN	5	76591765	missense	probably benign	0.29
IGL01599:Cep135	APN	5	76593347	missense	possibly damaging	0.93
IGL01923:Cep135	APN	5	76640982	makesense	probably null
IGL02178:Cep135	APN	5	76595474	missense	probably damaging	1.00
IGL02276:Cep135	APN	5	76634246	missense	probably benign	0.00
IGL02344:Cep135	APN	5	76616821	missense	probably benign
IGL02394:Cep135	APN	5	76631471	missense	probably benign	0.02
IGL02740:Cep135	APN	5	76638268	critical splice donor site	probably null
IGL02832:Cep135	APN	5	76640949	missense	probably damaging	0.98
R0026:Cep135	UTSW	5	76606734	nonsense	probably null
R0060:Cep135	UTSW	5	76621350	missense	probably benign	0.20
R0325:Cep135	UTSW	5	76615743	missense	probably damaging	0.98
R0336:Cep135	UTSW	5	76601502	missense	probably benign	0.07
R0564:Cep135	UTSW	5	76615710	missense	probably damaging	1.00
R0564:Cep135	UTSW	5	76638949	missense	probably benign	0.03
R0600:Cep135	UTSW	5	76621305	missense	probably benign
R0636:Cep135	UTSW	5	76615657	missense	probably benign	0.07
R0704:Cep135	UTSW	5	76630949	missense	possibly damaging	0.62
R0835:Cep135	UTSW	5	76615706	missense	probably benign	0.40
R1015:Cep135	UTSW	5	76640997	critical splice donor site	probably null
R1167:Cep135	UTSW	5	76624637	missense	probably damaging	1.00
R1252:Cep135	UTSW	5	76594115	missense	possibly damaging	0.67
R1554:Cep135	UTSW	5	76634213	nonsense	probably null
R1770:Cep135	UTSW	5	76603195	missense	possibly damaging	0.95
R1804:Cep135	UTSW	5	76636932	missense	probably benign	0.22
R1968:Cep135	UTSW	5	76624747	missense	possibly damaging	0.96
R1987:Cep135	UTSW	5	76597428	missense	probably benign	0.00
R1996:Cep135	UTSW	5	76632266	missense	probably benign	0.08
R2004:Cep135	UTSW	5	76632329	critical splice donor site	probably null
R2178:Cep135	UTSW	5	76631450	missense	probably benign	0.00
R2305:Cep135	UTSW	5	76595389	splice site	probably benign
R2679:Cep135	UTSW	5	76624660	missense	probably benign
R3125:Cep135	UTSW	5	76621363	critical splice donor site	probably null
R3623:Cep135	UTSW	5	76624739	missense	probably benign	0.00
R4359:Cep135	UTSW	5	76611714	missense	possibly damaging	0.47
R4407:Cep135	UTSW	5	76624667	missense	probably benign
R4561:Cep135	UTSW	5	76638193	missense	possibly damaging	0.95
R4666:Cep135	UTSW	5	76616854	missense	probably benign
R4945:Cep135	UTSW	5	76597428	missense	probably benign	0.00
R5105:Cep135	UTSW	5	76594092	missense	probably benign	0.00
R5117:Cep135	UTSW	5	76631429	missense	probably benign	0.01
R5176:Cep135	UTSW	5	76637026	missense	probably benign	0.04
R5194:Cep135	UTSW	5	76615777	missense	probably benign	0.05
R5233:Cep135	UTSW	5	76591843	small deletion	probably benign
R5275:Cep135	UTSW	5	76593204	missense	possibly damaging	0.94
R5295:Cep135	UTSW	5	76593204	missense	possibly damaging	0.94
R5412:Cep135	UTSW	5	76616862	missense	probably benign	0.00
R5427:Cep135	UTSW	5	76638202	missense	probably benign	0.00
R5801:Cep135	UTSW	5	76630676	missense	probably damaging	1.00
R5975:Cep135	UTSW	5	76640890	missense	possibly damaging	0.94
R6087:Cep135	UTSW	5	76615791	critical splice donor site	probably null
R6176:Cep135	UTSW	5	76624643	missense	probably benign
R6210:Cep135	UTSW	5	76624723	missense	probably benign	0.15
R6456:Cep135	UTSW	5	76591724	start gained	probably benign
R6467:Cep135	UTSW	5	76621340	missense	possibly damaging	0.50
R6622:Cep135	UTSW	5	76640968	missense	probably benign	0.00
R6650:Cep135	UTSW	5	76633701	missense	possibly damaging	0.77
R6838:Cep135	UTSW	5	76632215	missense	probably damaging	1.00
R7028:Cep135	UTSW	5	76616848	missense	probably benign
R7049:Cep135	UTSW	5	76606738	missense	probably benign	0.01
R7207:Cep135	UTSW	5	76632243	missense	probably benign	0.00
R7330:Cep135	UTSW	5	76606745	nonsense	probably null
R7369:Cep135	UTSW	5	76593253	missense	possibly damaging	0.94
R7741:Cep135	UTSW	5	76630970	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACTGGATCAAACCCATGGTAC -3'
(R):5'- AAACCAGAGCGTTACCAGGG -3'

Sequencing Primer
(F):5'- AAAATCCCAAAGTCTCTTTCTGTGC -3'
(R):5'- AGAGCGTTACCAGGGGTCTG -3'

Posted On

2019-05-15