Incidental Mutation 'R7095:Cep135'
Institutional Source Beutler Lab
Gene Symbol Cep135
Ensembl Gene ENSMUSG00000036403
Gene Namecentrosomal protein 135
SynonymsLOC381644, Cep4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7095 (G1)
Quality Score225.009
Status Validated
Chromosomal Location76588698-76646466 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76594058 bp
Amino Acid Change Threonine to Alanine at position 114 (T114A)
Ref Sequence ENSEMBL: ENSMUSP00000038674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049060] [ENSMUST00000121979]
Predicted Effect probably benign
Transcript: ENSMUST00000049060
AA Change: T114A

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000038674
Gene: ENSMUSG00000036403
AA Change: T114A

internal_repeat_1 47 71 1.87e-5 PROSPERO
low complexity region 78 92 N/A INTRINSIC
internal_repeat_1 100 124 1.87e-5 PROSPERO
coiled coil region 125 153 N/A INTRINSIC
coiled coil region 194 245 N/A INTRINSIC
coiled coil region 267 420 N/A INTRINSIC
coiled coil region 445 470 N/A INTRINSIC
Blast:HAMP 492 527 5e-11 BLAST
Blast:SPEC 760 863 6e-21 BLAST
low complexity region 1060 1072 N/A INTRINSIC
coiled coil region 1075 1117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121979
AA Change: T114A

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112602
Gene: ENSMUSG00000036403
AA Change: T114A

internal_repeat_1 47 71 1.87e-5 PROSPERO
low complexity region 78 92 N/A INTRINSIC
internal_repeat_1 100 124 1.87e-5 PROSPERO
coiled coil region 125 153 N/A INTRINSIC
coiled coil region 194 245 N/A INTRINSIC
coiled coil region 267 420 N/A INTRINSIC
coiled coil region 445 470 N/A INTRINSIC
Blast:HAMP 492 527 5e-11 BLAST
Blast:SPEC 760 863 6e-21 BLAST
low complexity region 1060 1072 N/A INTRINSIC
coiled coil region 1075 1117 N/A INTRINSIC
Meta Mutation Damage Score 0.0766 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein, which acts as a scaffolding protein during early centriole biogenesis, and is also required for centriole-centriole cohesion during interphase. Mutations in this gene are associated with autosomal recessive primary microcephaly-8. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A G 17: 35,957,511 V809A possibly damaging Het
Adam32 T A 8: 24,914,070 D242V probably damaging Het
Adamts9 T A 6: 92,887,691 H763L probably benign Het
Aff1 A G 5: 103,843,085 D967G probably damaging Het
Anpep A T 7: 79,842,202 L17Q possibly damaging Het
Appbp2 G T 11: 85,234,727 S28* probably null Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Bod1l A G 5: 41,795,068 probably null Het
Capn5 G A 7: 98,125,831 T534I probably benign Het
Cbx2 T C 11: 119,028,059 I150T probably damaging Het
Cdh11 A G 8: 102,658,267 V392A probably damaging Het
Cenpf A T 1: 189,659,176 C803S probably benign Het
Chd2 A T 7: 73,471,881 D994E probably damaging Het
Chtf18 C A 17: 25,722,678 W584C probably damaging Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
Dgkh C A 14: 78,627,784 M172I probably benign Het
Dpy19l2 T G 9: 24,695,814 H117P probably benign Het
Dzip3 A T 16: 48,927,790 N908K probably benign Het
Erc2 A T 14: 27,898,593 N393Y probably damaging Het
Fam118b T C 9: 35,221,490 E291G possibly damaging Het
Fam193a C T 5: 34,458,034 L816F probably damaging Het
Fat2 A G 11: 55,311,331 Y306H probably damaging Het
Fndc10 C T 4: 155,695,117 T206I probably damaging Het
Fzd1 GGGACTCCTCCACCTCCCTGGA GGGA 5: 4,755,824 probably benign Het
Gsk3a A T 7: 25,233,854 Y177N probably damaging Het
Haus5 T C 7: 30,659,572 T222A probably benign Het
Igfbp7 G T 5: 77,401,490 Q189K probably benign Het
Inppl1 A T 7: 101,827,456 Y771* probably null Het
Iqck A T 7: 118,915,591 Y234F probably damaging Het
Irs1 G T 1: 82,290,098 C132* probably null Het
Jmjd1c T G 10: 67,219,632 V277G probably benign Het
Klhl22 G A 16: 17,792,750 V622M probably damaging Het
Kri1 C T 9: 21,279,432 E378K Het
Lilra6 C T 7: 3,913,197 G221D probably damaging Het
Marc1 A G 1: 184,795,240 L297P probably damaging Het
Mecom T C 3: 29,980,954 E191G probably damaging Het
Mgrn1 T A 16: 4,927,664 probably null Het
Mical1 C T 10: 41,479,210 probably null Het
Mlxipl T C 5: 135,134,030 Y711H possibly damaging Het
Mpl T A 4: 118,444,063 H535L Het
Mtfr2 C A 10: 20,352,920 H71N probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh15 A G 16: 49,171,909 Q1582R possibly damaging Het
Neb C T 2: 52,177,623 E6062K possibly damaging Het
Nlrp4c G A 7: 6,060,793 A67T probably damaging Het
Noc3l T A 19: 38,812,345 H231L probably benign Het
Odf1 T C 15: 38,219,559 Y44H possibly damaging Het
Olfr1052 C T 2: 86,298,677 P287L probably benign Het
Olfr589 G A 7: 103,155,330 T139I probably damaging Het
Olfr591 C T 7: 103,173,046 R197H probably benign Het
Otol1 G T 3: 70,018,694 E67D probably benign Het
Otud7b A G 3: 96,155,237 S598G probably benign Het
Ppwd1 T A 13: 104,205,626 T607S probably benign Het
Prag1 A G 8: 36,102,560 N99S probably benign Het
Ralgds C A 2: 28,549,308 Q737K possibly damaging Het
Scyl2 T C 10: 89,669,687 H98R probably damaging Het
Secisbp2 A C 13: 51,677,254 Q575H probably benign Het
Slc9a5 A T 8: 105,357,636 H497L probably benign Het
Sufu T A 19: 46,475,588 V414E probably damaging Het
Tbc1d22b A T 17: 29,599,869 E399V probably damaging Het
Tcp10c G A 17: 13,355,934 V59I probably benign Het
Tdpoz3 T C 3: 93,827,061 S348P probably benign Het
Tmem219 A T 7: 126,891,756 F176L probably damaging Het
Trav6-2 A G 14: 52,667,834 D104G probably damaging Het
Uba7 A G 9: 107,983,339 K927R probably benign Het
Vps54 T G 11: 21,271,720 D158E probably benign Het
Xpnpep1 C T 19: 53,011,765 probably null Het
Xpo7 G A 14: 70,704,706 R73W probably damaging Het
Zfp532 A T 18: 65,682,898 M781L probably benign Het
Zfp930 T A 8: 69,228,541 I295K probably benign Het
Other mutations in Cep135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Cep135 APN 5 76601459 missense probably damaging 0.98
IGL01154:Cep135 APN 5 76606796 splice site probably benign
IGL01323:Cep135 APN 5 76591765 missense probably benign 0.29
IGL01599:Cep135 APN 5 76593347 missense possibly damaging 0.93
IGL01923:Cep135 APN 5 76640982 makesense probably null
IGL02178:Cep135 APN 5 76595474 missense probably damaging 1.00
IGL02276:Cep135 APN 5 76634246 missense probably benign 0.00
IGL02344:Cep135 APN 5 76616821 missense probably benign
IGL02394:Cep135 APN 5 76631471 missense probably benign 0.02
IGL02740:Cep135 APN 5 76638268 critical splice donor site probably null
IGL02832:Cep135 APN 5 76640949 missense probably damaging 0.98
R0026:Cep135 UTSW 5 76606734 nonsense probably null
R0060:Cep135 UTSW 5 76621350 missense probably benign 0.20
R0325:Cep135 UTSW 5 76615743 missense probably damaging 0.98
R0336:Cep135 UTSW 5 76601502 missense probably benign 0.07
R0564:Cep135 UTSW 5 76615710 missense probably damaging 1.00
R0564:Cep135 UTSW 5 76638949 missense probably benign 0.03
R0600:Cep135 UTSW 5 76621305 missense probably benign
R0636:Cep135 UTSW 5 76615657 missense probably benign 0.07
R0704:Cep135 UTSW 5 76630949 missense possibly damaging 0.62
R0835:Cep135 UTSW 5 76615706 missense probably benign 0.40
R1015:Cep135 UTSW 5 76640997 critical splice donor site probably null
R1167:Cep135 UTSW 5 76624637 missense probably damaging 1.00
R1252:Cep135 UTSW 5 76594115 missense possibly damaging 0.67
R1554:Cep135 UTSW 5 76634213 nonsense probably null
R1770:Cep135 UTSW 5 76603195 missense possibly damaging 0.95
R1804:Cep135 UTSW 5 76636932 missense probably benign 0.22
R1968:Cep135 UTSW 5 76624747 missense possibly damaging 0.96
R1987:Cep135 UTSW 5 76597428 missense probably benign 0.00
R1996:Cep135 UTSW 5 76632266 missense probably benign 0.08
R2004:Cep135 UTSW 5 76632329 critical splice donor site probably null
R2178:Cep135 UTSW 5 76631450 missense probably benign 0.00
R2305:Cep135 UTSW 5 76595389 splice site probably benign
R2679:Cep135 UTSW 5 76624660 missense probably benign
R3125:Cep135 UTSW 5 76621363 critical splice donor site probably null
R3623:Cep135 UTSW 5 76624739 missense probably benign 0.00
R4359:Cep135 UTSW 5 76611714 missense possibly damaging 0.47
R4407:Cep135 UTSW 5 76624667 missense probably benign
R4561:Cep135 UTSW 5 76638193 missense possibly damaging 0.95
R4666:Cep135 UTSW 5 76616854 missense probably benign
R4945:Cep135 UTSW 5 76597428 missense probably benign 0.00
R5105:Cep135 UTSW 5 76594092 missense probably benign 0.00
R5117:Cep135 UTSW 5 76631429 missense probably benign 0.01
R5176:Cep135 UTSW 5 76637026 missense probably benign 0.04
R5194:Cep135 UTSW 5 76615777 missense probably benign 0.05
R5233:Cep135 UTSW 5 76591843 small deletion probably benign
R5275:Cep135 UTSW 5 76593204 missense possibly damaging 0.94
R5295:Cep135 UTSW 5 76593204 missense possibly damaging 0.94
R5412:Cep135 UTSW 5 76616862 missense probably benign 0.00
R5427:Cep135 UTSW 5 76638202 missense probably benign 0.00
R5801:Cep135 UTSW 5 76630676 missense probably damaging 1.00
R5975:Cep135 UTSW 5 76640890 missense possibly damaging 0.94
R6087:Cep135 UTSW 5 76615791 critical splice donor site probably null
R6176:Cep135 UTSW 5 76624643 missense probably benign
R6210:Cep135 UTSW 5 76624723 missense probably benign 0.15
R6456:Cep135 UTSW 5 76591724 start gained probably benign
R6467:Cep135 UTSW 5 76621340 missense possibly damaging 0.50
R6622:Cep135 UTSW 5 76640968 missense probably benign 0.00
R6650:Cep135 UTSW 5 76633701 missense possibly damaging 0.77
R6838:Cep135 UTSW 5 76632215 missense probably damaging 1.00
R7028:Cep135 UTSW 5 76616848 missense probably benign
R7049:Cep135 UTSW 5 76606738 missense probably benign 0.01
R7207:Cep135 UTSW 5 76632243 missense probably benign 0.00
R7330:Cep135 UTSW 5 76606745 nonsense probably null
R7369:Cep135 UTSW 5 76593253 missense possibly damaging 0.94
R7741:Cep135 UTSW 5 76630970 missense probably damaging 0.99
R7850:Cep135 UTSW 5 76591873 critical splice donor site probably null
R7869:Cep135 UTSW 5 76640956 missense probably benign 0.00
R7923:Cep135 UTSW 5 76609692 missense possibly damaging 0.90
R8303:Cep135 UTSW 5 76611728 missense probably damaging 1.00
R8312:Cep135 UTSW 5 76636899 missense probably damaging 1.00
R8424:Cep135 UTSW 5 76594059 missense possibly damaging 0.64
R8490:Cep135 UTSW 5 76638207 missense probably benign 0.00
Z1177:Cep135 UTSW 5 76591826 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-05-15