Incidental Mutation 'R5870:Olfr589'
ID455126
Institutional Source Beutler Lab
Gene Symbol Olfr589
Ensembl Gene ENSMUSG00000051362
Gene Nameolfactory receptor 589
SynonymsMOR32-3, GA_x6K02T2PBJ9-5871256-5870303
MMRRC Submission 044078-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5870 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103154792-103156356 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103155741 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 2 (I2T)
Ref Sequence ENSEMBL: ENSMUSP00000151739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061055] [ENSMUST00000218483]
Predicted Effect probably benign
Transcript: ENSMUST00000061055
AA Change: I2T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000060166
Gene: ENSMUSG00000051362
AA Change: I2T

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 3.1e-132 PFAM
Pfam:7TM_GPCR_Srsx 37 171 1.5e-7 PFAM
Pfam:7tm_1 43 293 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218483
AA Change: I2T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 93% (84/90)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A G 16: 4,418,368 V156A probably damaging Het
Ak6 C A 13: 100,655,424 P125Q probably damaging Het
Aqp4 A C 18: 15,399,889 V49G probably damaging Het
Arfgef1 A G 1: 10,180,938 I874T probably damaging Het
Arid1a T C 4: 133,681,076 D2040G unknown Het
Atp1a3 T G 7: 24,997,578 D220A probably benign Het
C2cd4c A T 10: 79,612,209 I368N possibly damaging Het
Ccnt1 G A 15: 98,543,513 Q625* probably null Het
Cd177 T A 7: 24,756,332 H255L probably benign Het
Cdipt G A 7: 126,978,922 V114M probably benign Het
Coro1b T A 19: 4,149,385 H14Q probably damaging Het
Ctdp1 T A 18: 80,408,686 D158V unknown Het
Cts7 A T 13: 61,355,731 S140T probably damaging Het
Dlgap3 T A 4: 127,195,709 L366* probably null Het
Dnah9 C T 11: 66,085,210 A1338T probably benign Het
Dock7 T C 4: 99,063,962 I424V probably benign Het
Dock8 G T 19: 25,132,126 A891S probably benign Het
Elmod3 A G 6: 72,594,738 probably null Het
Eps15 G A 4: 109,361,310 E107K probably damaging Het
Esco1 A T 18: 10,593,744 probably null Het
Fuz A G 7: 44,900,318 T407A probably damaging Het
Galr1 A T 18: 82,406,072 F27I probably benign Het
Glt1d1 A G 5: 127,677,280 Y182C probably damaging Het
Gm37240 A T 3: 84,690,521 probably benign Het
Gm37610 A G 6: 41,084,914 noncoding transcript Het
Gm6658 G T 8: 90,908,392 probably benign Het
Gm9376 A G 14: 118,267,377 T74A possibly damaging Het
Hadha G A 5: 30,144,286 S109F possibly damaging Het
Herc3 A T 6: 58,916,450 Q899L probably benign Het
Ift172 C T 5: 31,276,940 E485K probably benign Het
Lrrc8e A G 8: 4,235,725 K650R possibly damaging Het
Ly6d A T 15: 74,763,532 V10D possibly damaging Het
Med27 A G 2: 29,389,811 probably null Het
Med29 A T 7: 28,392,497 V56E probably damaging Het
Mobp A G 9: 120,167,853 K17E probably damaging Het
Mrpl37 G A 4: 107,066,722 T25I probably benign Het
Myh1 A G 11: 67,201,979 D33G possibly damaging Het
Nrg3 T A 14: 39,472,629 I58F possibly damaging Het
Olfr872 A G 9: 20,260,578 D246G probably benign Het
Padi1 T A 4: 140,826,581 D359V probably benign Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pgm3 C A 9: 86,570,361 K15N probably damaging Het
Phip A T 9: 82,908,677 probably benign Het
Pot1a G A 6: 25,778,951 T48I possibly damaging Het
Ppic T C 18: 53,409,261 K125R probably benign Het
Ppm1j T C 3: 104,785,495 V440A possibly damaging Het
Prg4 T A 1: 150,455,549 K458* probably null Het
Rd3 A T 1: 191,985,300 M244L probably benign Het
Rflnb A G 11: 76,022,038 Y175H probably benign Het
Rnf157 T A 11: 116,347,074 S574C probably benign Het
Sardh A G 2: 27,220,641 probably null Het
Senp3 C T 11: 69,678,222 probably null Het
Siglec1 G A 2: 131,072,847 R1450C probably damaging Het
Sim2 A G 16: 94,123,334 H446R probably damaging Het
Spon1 T C 7: 114,031,786 I444T probably damaging Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Stxbp4 A T 11: 90,537,956 I441N possibly damaging Het
Sugt1 G A 14: 79,609,011 V163I probably benign Het
Surf1 G T 2: 26,916,259 probably benign Het
Synj2 A G 17: 6,037,853 E1348G probably benign Het
Tc2n A T 12: 101,652,852 V349D probably damaging Het
Ten1 A G 11: 116,214,925 R112G possibly damaging Het
Tm9sf4 A G 2: 153,194,281 D321G probably damaging Het
Ttll12 A T 15: 83,577,036 M594K probably damaging Het
Ttn T A 2: 76,872,714 probably benign Het
Usp28 C T 9: 49,025,985 Q185* probably null Het
Vmn2r112 A G 17: 22,619,023 I822V probably benign Het
Wdr60 A G 12: 116,256,245 S26P possibly damaging Het
Zc3hc1 A T 6: 30,382,683 L88* probably null Het
Zfr T A 15: 12,160,615 V758D probably damaging Het
Zfyve27 T G 19: 42,171,671 L42R probably benign Het
Other mutations in Olfr589
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01955:Olfr589 APN 7 103154854 nonsense probably null
IGL02059:Olfr589 APN 7 103155103 missense probably benign 0.14
IGL02336:Olfr589 APN 7 103155565 missense probably benign 0.09
IGL03355:Olfr589 APN 7 103155201 missense probably damaging 1.00
PIT4508001:Olfr589 UTSW 7 103155313 missense probably benign
R0900:Olfr589 UTSW 7 103155313 missense probably benign
R2250:Olfr589 UTSW 7 103154950 missense probably damaging 1.00
R3500:Olfr589 UTSW 7 103155090 missense probably damaging 1.00
R4756:Olfr589 UTSW 7 103155125 missense probably benign 0.24
R4776:Olfr589 UTSW 7 103155414 missense probably benign 0.40
R5022:Olfr589 UTSW 7 103155735 missense probably benign
R5151:Olfr589 UTSW 7 103155386 missense probably damaging 0.99
R5231:Olfr589 UTSW 7 103154968 missense probably damaging 1.00
R5973:Olfr589 UTSW 7 103154874 missense possibly damaging 0.93
R6567:Olfr589 UTSW 7 103154928 missense possibly damaging 0.94
R7095:Olfr589 UTSW 7 103155330 missense probably damaging 1.00
R8214:Olfr589 UTSW 7 103155406 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGAGAGGCCCAAGTCAATG -3'
(R):5'- TTCCTTGTGGTATGCAGTGCAC -3'

Sequencing Primer
(F):5'- AGGCCCAAGTCAATGGTAGCC -3'
(R):5'- GCAGTGCACTTGAAATTCGC -3'
Posted On2017-02-10