Incidental Mutation 'PIT4495001:Svs1'
ID555956
Institutional Source Beutler Lab
Gene Symbol Svs1
Ensembl Gene ENSMUSG00000039215
Gene Nameseminal vesicle secretory protein 1
SynonymsSVS I
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #PIT4495001 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location48986861-48991722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48987776 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 239 (E239D)
Ref Sequence ENSEMBL: ENSMUSP00000045221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037696]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037696
AA Change: E239D

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045221
Gene: ENSMUSG00000039215
AA Change: E239D

DomainStartEndE-ValueType
Pfam:Cu_amine_oxidN2 44 130 1.5e-24 PFAM
Pfam:Cu_amine_oxidN3 146 246 2.7e-16 PFAM
internal_repeat_1 286 342 7.28e-22 PROSPERO
Pfam:Cu_amine_oxid 408 811 2e-92 PFAM
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.6%
  • 10x: 84.0%
  • 20x: 69.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik A T 10: 100,583,950 F90I probably damaging Het
Abl2 T A 1: 156,633,185 V384D probably damaging Het
Adamts7 A G 9: 90,174,622 E248G probably damaging Het
Aff1 A G 5: 103,849,525 T1162A probably benign Het
Ank3 C A 10: 69,993,072 H2524N Het
Cct7 T A 6: 85,459,961 N60K probably damaging Het
Cfap43 A C 19: 47,897,302 C291W probably damaging Het
Cobl G A 11: 12,254,596 T702I probably benign Het
Col5a1 C A 2: 28,024,776 Q1624K unknown Het
Cubn T A 2: 13,491,750 T22S probably benign Het
Def8 A C 8: 123,459,553 M344L probably benign Het
Fzd7 A G 1: 59,484,307 T450A probably benign Het
Gm11214 G A 4: 63,662,685 L76F probably benign Het
Gm14548 A T 7: 3,897,458 C98S probably damaging Het
Gm5797 T C 14: 7,329,530 T153A probably benign Het
Gsk3a A C 7: 25,235,639 S129A probably damaging Het
Intu A G 3: 40,697,603 Q830R probably benign Het
Kcnma1 C T 14: 23,425,597 V750I probably benign Het
Mlh1 T A 9: 111,247,260 Y343F probably benign Het
Myb C T 10: 21,152,622 R114H probably damaging Het
Neb A T 2: 52,212,736 D4508E probably benign Het
Nell2 T C 15: 95,383,727 D366G probably benign Het
Olfr1354 T C 10: 78,916,987 V49A probably benign Het
Olfr1428 A G 19: 12,108,712 I52T possibly damaging Het
Olfr196 G T 16: 59,167,974 H56Q possibly damaging Het
Olfr209 A C 16: 59,361,508 F237V probably damaging Het
Olfr98 A C 17: 37,262,830 V278G possibly damaging Het
Pcdhgc5 C T 18: 37,820,977 H435Y possibly damaging Het
Pnpla7 T A 2: 25,042,139 D935E probably damaging Het
Pole A G 5: 110,303,914 E874G probably damaging Het
Psd3 A C 8: 67,963,913 I158R probably benign Het
Pzp C A 6: 128,502,229 V654L probably benign Het
Rabep1 A G 11: 70,917,579 T454A probably damaging Het
Rad54l2 C A 9: 106,716,144 S419I probably benign Het
Rin3 A G 12: 102,369,036 D402G probably benign Het
Ripk4 T C 16: 97,743,170 H759R probably damaging Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Sf3a3 C T 4: 124,728,320 P391L probably damaging Het
Snx9 T A 17: 5,920,126 I379K possibly damaging Het
Syt5 A C 7: 4,541,078 probably null Het
Tex47 A G 5: 7,305,011 D64G probably benign Het
Zbbx C A 3: 75,061,637 W509L probably damaging Het
Zer1 T C 2: 30,103,543 K551R probably benign Het
Other mutations in Svs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Svs1 APN 6 48987739 missense probably damaging 0.98
IGL01876:Svs1 APN 6 48990036 missense possibly damaging 0.71
IGL01934:Svs1 APN 6 48988761 missense probably damaging 0.97
IGL03002:Svs1 APN 6 48987118 missense probably benign 0.01
IGL03059:Svs1 APN 6 48987415 missense probably benign 0.13
IGL03213:Svs1 APN 6 48988345 missense possibly damaging 0.92
IGL03249:Svs1 APN 6 48988369 missense probably benign
IGL03365:Svs1 APN 6 48988597 missense probably damaging 0.97
PIT4280001:Svs1 UTSW 6 48987120 missense probably benign 0.01
R0010:Svs1 UTSW 6 48988906 missense probably damaging 0.99
R0528:Svs1 UTSW 6 48988031 missense probably benign
R0784:Svs1 UTSW 6 48987301 missense possibly damaging 0.78
R0959:Svs1 UTSW 6 48988632 missense possibly damaging 0.89
R1173:Svs1 UTSW 6 48990239 missense probably damaging 1.00
R1174:Svs1 UTSW 6 48990239 missense probably damaging 1.00
R1175:Svs1 UTSW 6 48990239 missense probably damaging 1.00
R1940:Svs1 UTSW 6 48990073 nonsense probably null
R3115:Svs1 UTSW 6 48987397 missense probably damaging 0.99
R3116:Svs1 UTSW 6 48987397 missense probably damaging 0.99
R3808:Svs1 UTSW 6 48987994 missense possibly damaging 0.93
R3809:Svs1 UTSW 6 48987994 missense possibly damaging 0.93
R3852:Svs1 UTSW 6 48987994 missense possibly damaging 0.93
R4455:Svs1 UTSW 6 48987460 missense possibly damaging 0.56
R4898:Svs1 UTSW 6 48987717 missense possibly damaging 0.95
R4933:Svs1 UTSW 6 48987492 missense probably damaging 1.00
R5108:Svs1 UTSW 6 48988570 missense probably damaging 0.97
R5320:Svs1 UTSW 6 48987575 missense probably benign 0.02
R6053:Svs1 UTSW 6 48988488 missense probably benign 0.42
R6728:Svs1 UTSW 6 48988845 missense possibly damaging 0.86
R6922:Svs1 UTSW 6 48987574 missense probably damaging 0.99
R7045:Svs1 UTSW 6 48988612 missense possibly damaging 0.81
R7046:Svs1 UTSW 6 48987578 missense probably benign 0.11
R7137:Svs1 UTSW 6 48990149 missense probably damaging 1.00
R7267:Svs1 UTSW 6 48988018 small deletion probably benign
R7874:Svs1 UTSW 6 48988666 missense possibly damaging 0.91
R7993:Svs1 UTSW 6 48987608 missense possibly damaging 0.85
R8238:Svs1 UTSW 6 48990041 missense probably damaging 0.96
X0022:Svs1 UTSW 6 48988339 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATACCACTGGCTTCACACTGC -3'
(R):5'- ATAGAGCTGGATCACTCGAGGG -3'

Sequencing Primer
(F):5'- TGGCTTCACACTGCAGGACTG -3'
(R):5'- ATCACTCGAGGGCCACC -3'
Posted On2019-06-07