Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4495001:Snx9'

555981

Institutional Source

Beutler Lab

Gene Symbol

Snx9

Ensembl Gene

ENSMUSG00000002365

Gene Name

sorting nexin 9

Synonyms

SH3PX1, SDP1

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.669) question?

Stock #

PIT4495001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

5841329-5931954 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 5920126 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 379 (I379K)

Ref Sequence

ENSEMBL: ENSMUSP00000002436 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002436]

PDB Structure

Solution structure of the SH3 domain from mouse sorting nexin-9 [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000002436
AA Change: I379K

PolyPhen 2 Score 0.542 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000002436
Gene: ENSMUSG00000002365
AA Change: I379K

Domain	Start	End	E-Value	Type
SH3	3	61	1.51e-16	SMART
low complexity region	84	100	N/A	INTRINSIC
low complexity region	160	170	N/A	INTRINSIC
PX	247	357	4.15e-23	SMART
Pfam:BAR_3_WASP_bdg	358	593	2.4e-120	PFAM

Coding Region Coverage

1x: 93.1%
3x: 90.6%
10x: 84.0%
20x: 69.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phosphoinositide binding domain, and are involved in intracellular trafficking. The encoded protein does not contain a coiled coil region, like some family members, but does contain a SRC homology domain near its N-terminus. The encoded protein is reported to have a variety of interaction partners, including of adaptor protein 2 , dynamin, tyrosine kinase non-receptor 2, Wiskott-Aldrich syndrome-like, and ARP3 actin-related protein 3. The encoded protein is implicated in several stages of intracellular trafficking, including endocytosis, macropinocytosis, and F-actin nucleation. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430F08Rik	A	T	10: 100,583,950	F90I	probably damaging	Het
Abl2	T	A	1: 156,633,185	V384D	probably damaging	Het
Adamts7	A	G	9: 90,174,622	E248G	probably damaging	Het
Aff1	A	G	5: 103,849,525	T1162A	probably benign	Het
Ank3	C	A	10: 69,993,072	H2524N		Het
Cct7	T	A	6: 85,459,961	N60K	probably damaging	Het
Cfap43	A	C	19: 47,897,302	C291W	probably damaging	Het
Cobl	G	A	11: 12,254,596	T702I	probably benign	Het
Col5a1	C	A	2: 28,024,776	Q1624K	unknown	Het
Cubn	T	A	2: 13,491,750	T22S	probably benign	Het
Def8	A	C	8: 123,459,553	M344L	probably benign	Het
Fzd7	A	G	1: 59,484,307	T450A	probably benign	Het
Gm11214	G	A	4: 63,662,685	L76F	probably benign	Het
Gm14548	A	T	7: 3,897,458	C98S	probably damaging	Het
Gm5797	T	C	14: 7,329,530	T153A	probably benign	Het
Gsk3a	A	C	7: 25,235,639	S129A	probably damaging	Het
Intu	A	G	3: 40,697,603	Q830R	probably benign	Het
Kcnma1	C	T	14: 23,425,597	V750I	probably benign	Het
Mlh1	T	A	9: 111,247,260	Y343F	probably benign	Het
Myb	C	T	10: 21,152,622	R114H	probably damaging	Het
Neb	A	T	2: 52,212,736	D4508E	probably benign	Het
Nell2	T	C	15: 95,383,727	D366G	probably benign	Het
Olfr1354	T	C	10: 78,916,987	V49A	probably benign	Het
Olfr1428	A	G	19: 12,108,712	I52T	possibly damaging	Het
Olfr196	G	T	16: 59,167,974	H56Q	possibly damaging	Het
Olfr209	A	C	16: 59,361,508	F237V	probably damaging	Het
Olfr98	A	C	17: 37,262,830	V278G	possibly damaging	Het
Pcdhgc5	C	T	18: 37,820,977	H435Y	possibly damaging	Het
Pnpla7	T	A	2: 25,042,139	D935E	probably damaging	Het
Pole	A	G	5: 110,303,914	E874G	probably damaging	Het
Psd3	A	C	8: 67,963,913	I158R	probably benign	Het
Pzp	C	A	6: 128,502,229	V654L	probably benign	Het
Rabep1	A	G	11: 70,917,579	T454A	probably damaging	Het
Rad54l2	C	A	9: 106,716,144	S419I	probably benign	Het
Rin3	A	G	12: 102,369,036	D402G	probably benign	Het
Ripk4	T	C	16: 97,743,170	H759R	probably damaging	Het
Sbsn	GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA	GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA	7: 30,752,966		probably benign	Het
Sf3a3	C	T	4: 124,728,320	P391L	probably damaging	Het
Svs1	A	T	6: 48,987,776	E239D	possibly damaging	Het
Syt5	A	C	7: 4,541,078		probably null	Het
Tex47	A	G	5: 7,305,011	D64G	probably benign	Het
Zbbx	C	A	3: 75,061,637	W509L	probably damaging	Het
Zer1	T	C	2: 30,103,543	K551R	probably benign	Het

Other mutations in Snx9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Snx9	APN	17	5899361	missense	probably benign
IGL00417:Snx9	APN	17	5891897	missense	probably benign	0.03
IGL01827:Snx9	APN	17	5887012	missense	probably benign	0.04
IGL02531:Snx9	APN	17	5891820	missense	probably benign
IGL02710:Snx9	APN	17	5908598	missense	probably damaging	1.00
IGL03088:Snx9	APN	17	5924610	missense	probably benign
san_angelo	UTSW	17	5891809	nonsense	probably null
R0555:Snx9	UTSW	17	5918413	missense	probably damaging	0.97
R1015:Snx9	UTSW	17	5920127	missense	probably benign	0.12
R1065:Snx9	UTSW	17	5902361	splice site	probably benign
R1421:Snx9	UTSW	17	5902484	missense	probably benign	0.45
R1657:Snx9	UTSW	17	5918436	missense	possibly damaging	0.65
R1823:Snx9	UTSW	17	5920671	missense	probably damaging	1.00
R1914:Snx9	UTSW	17	5928256	missense	possibly damaging	0.65
R3703:Snx9	UTSW	17	5928200	splice site	probably null
R3871:Snx9	UTSW	17	5891781	missense	probably benign	0.00
R4375:Snx9	UTSW	17	5908626	nonsense	probably null
R4412:Snx9	UTSW	17	5908394	missense	probably damaging	0.96
R4669:Snx9	UTSW	17	5927224	missense	probably damaging	1.00
R4974:Snx9	UTSW	17	5902519	splice site	probably null
R5038:Snx9	UTSW	17	5887073	missense	probably benign	0.12
R5137:Snx9	UTSW	17	5928253	missense	probably damaging	1.00
R5369:Snx9	UTSW	17	5920580	missense	probably damaging	1.00
R5459:Snx9	UTSW	17	5920638	missense	probably damaging	0.99
R5624:Snx9	UTSW	17	5891809	nonsense	probably null
R5847:Snx9	UTSW	17	5924621	missense	possibly damaging	0.94
R5953:Snx9	UTSW	17	5908402	missense	probably damaging	1.00
R5953:Snx9	UTSW	17	5908403	missense	probably damaging	1.00
R6263:Snx9	UTSW	17	5887049	missense	probably damaging	0.98
R6481:Snx9	UTSW	17	5922209	critical splice donor site	probably null
R6491:Snx9	UTSW	17	5920162	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CGTTGCAAAAGAGATGTGCCTG -3'
(R):5'- ATGGAGCCTAACCTGCTGAG -3'

Sequencing Primer
(F):5'- AAAGAGATGTGCCTGAGTCTGTCC -3'
(R):5'- GGTGGACACCGTCTAACTG -3'

Posted On

2019-06-07