Incidental Mutation 'PIT4495001:Snx9'
ID555981
Institutional Source Beutler Lab
Gene Symbol Snx9
Ensembl Gene ENSMUSG00000002365
Gene Namesorting nexin 9
SynonymsSH3PX1, SDP1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.669) question?
Stock #PIT4495001 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location5841329-5931954 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5920126 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 379 (I379K)
Ref Sequence ENSEMBL: ENSMUSP00000002436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002436]
PDB Structure
Solution structure of the SH3 domain from mouse sorting nexin-9 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002436
AA Change: I379K

PolyPhen 2 Score 0.542 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000002436
Gene: ENSMUSG00000002365
AA Change: I379K

DomainStartEndE-ValueType
SH3 3 61 1.51e-16 SMART
low complexity region 84 100 N/A INTRINSIC
low complexity region 160 170 N/A INTRINSIC
PX 247 357 4.15e-23 SMART
Pfam:BAR_3_WASP_bdg 358 593 2.4e-120 PFAM
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.6%
  • 10x: 84.0%
  • 20x: 69.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phosphoinositide binding domain, and are involved in intracellular trafficking. The encoded protein does not contain a coiled coil region, like some family members, but does contain a SRC homology domain near its N-terminus. The encoded protein is reported to have a variety of interaction partners, including of adaptor protein 2 , dynamin, tyrosine kinase non-receptor 2, Wiskott-Aldrich syndrome-like, and ARP3 actin-related protein 3. The encoded protein is implicated in several stages of intracellular trafficking, including endocytosis, macropinocytosis, and F-actin nucleation. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik A T 10: 100,583,950 F90I probably damaging Het
Abl2 T A 1: 156,633,185 V384D probably damaging Het
Adamts7 A G 9: 90,174,622 E248G probably damaging Het
Aff1 A G 5: 103,849,525 T1162A probably benign Het
Ank3 C A 10: 69,993,072 H2524N Het
Cct7 T A 6: 85,459,961 N60K probably damaging Het
Cfap43 A C 19: 47,897,302 C291W probably damaging Het
Cobl G A 11: 12,254,596 T702I probably benign Het
Col5a1 C A 2: 28,024,776 Q1624K unknown Het
Cubn T A 2: 13,491,750 T22S probably benign Het
Def8 A C 8: 123,459,553 M344L probably benign Het
Fzd7 A G 1: 59,484,307 T450A probably benign Het
Gm11214 G A 4: 63,662,685 L76F probably benign Het
Gm14548 A T 7: 3,897,458 C98S probably damaging Het
Gm5797 T C 14: 7,329,530 T153A probably benign Het
Gsk3a A C 7: 25,235,639 S129A probably damaging Het
Intu A G 3: 40,697,603 Q830R probably benign Het
Kcnma1 C T 14: 23,425,597 V750I probably benign Het
Mlh1 T A 9: 111,247,260 Y343F probably benign Het
Myb C T 10: 21,152,622 R114H probably damaging Het
Neb A T 2: 52,212,736 D4508E probably benign Het
Nell2 T C 15: 95,383,727 D366G probably benign Het
Olfr1354 T C 10: 78,916,987 V49A probably benign Het
Olfr1428 A G 19: 12,108,712 I52T possibly damaging Het
Olfr196 G T 16: 59,167,974 H56Q possibly damaging Het
Olfr209 A C 16: 59,361,508 F237V probably damaging Het
Olfr98 A C 17: 37,262,830 V278G possibly damaging Het
Pcdhgc5 C T 18: 37,820,977 H435Y possibly damaging Het
Pnpla7 T A 2: 25,042,139 D935E probably damaging Het
Pole A G 5: 110,303,914 E874G probably damaging Het
Psd3 A C 8: 67,963,913 I158R probably benign Het
Pzp C A 6: 128,502,229 V654L probably benign Het
Rabep1 A G 11: 70,917,579 T454A probably damaging Het
Rad54l2 C A 9: 106,716,144 S419I probably benign Het
Rin3 A G 12: 102,369,036 D402G probably benign Het
Ripk4 T C 16: 97,743,170 H759R probably damaging Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Sf3a3 C T 4: 124,728,320 P391L probably damaging Het
Svs1 A T 6: 48,987,776 E239D possibly damaging Het
Syt5 A C 7: 4,541,078 probably null Het
Tex47 A G 5: 7,305,011 D64G probably benign Het
Zbbx C A 3: 75,061,637 W509L probably damaging Het
Zer1 T C 2: 30,103,543 K551R probably benign Het
Other mutations in Snx9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Snx9 APN 17 5899361 missense probably benign
IGL00417:Snx9 APN 17 5891897 missense probably benign 0.03
IGL01827:Snx9 APN 17 5887012 missense probably benign 0.04
IGL02531:Snx9 APN 17 5891820 missense probably benign
IGL02710:Snx9 APN 17 5908598 missense probably damaging 1.00
IGL03088:Snx9 APN 17 5924610 missense probably benign
san_angelo UTSW 17 5891809 nonsense probably null
R0555:Snx9 UTSW 17 5918413 missense probably damaging 0.97
R1015:Snx9 UTSW 17 5920127 missense probably benign 0.12
R1065:Snx9 UTSW 17 5902361 splice site probably benign
R1421:Snx9 UTSW 17 5902484 missense probably benign 0.45
R1657:Snx9 UTSW 17 5918436 missense possibly damaging 0.65
R1823:Snx9 UTSW 17 5920671 missense probably damaging 1.00
R1914:Snx9 UTSW 17 5928256 missense possibly damaging 0.65
R3703:Snx9 UTSW 17 5928200 splice site probably null
R3871:Snx9 UTSW 17 5891781 missense probably benign 0.00
R4375:Snx9 UTSW 17 5908626 nonsense probably null
R4412:Snx9 UTSW 17 5908394 missense probably damaging 0.96
R4669:Snx9 UTSW 17 5927224 missense probably damaging 1.00
R4974:Snx9 UTSW 17 5902519 splice site probably null
R5038:Snx9 UTSW 17 5887073 missense probably benign 0.12
R5137:Snx9 UTSW 17 5928253 missense probably damaging 1.00
R5369:Snx9 UTSW 17 5920580 missense probably damaging 1.00
R5459:Snx9 UTSW 17 5920638 missense probably damaging 0.99
R5624:Snx9 UTSW 17 5891809 nonsense probably null
R5847:Snx9 UTSW 17 5924621 missense possibly damaging 0.94
R5953:Snx9 UTSW 17 5908402 missense probably damaging 1.00
R5953:Snx9 UTSW 17 5908403 missense probably damaging 1.00
R6263:Snx9 UTSW 17 5887049 missense probably damaging 0.98
R6481:Snx9 UTSW 17 5922209 critical splice donor site probably null
R6491:Snx9 UTSW 17 5920162 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGTTGCAAAAGAGATGTGCCTG -3'
(R):5'- ATGGAGCCTAACCTGCTGAG -3'

Sequencing Primer
(F):5'- AAAGAGATGTGCCTGAGTCTGTCC -3'
(R):5'- GGTGGACACCGTCTAACTG -3'
Posted On2019-06-07