Mutagenetix > Incidental Mutation

Incidental Mutation 'R3874:Acox2'

276749

Institutional Source

Beutler Lab

Gene Symbol

Acox2

Ensembl Gene

ENSMUSG00000021751

Gene Name

acyl-Coenzyme A oxidase 2, branched chain

Synonyms

MMRRC Submission

040792-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R3874 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8225511-8259353 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 8248061 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 407 (I407T)

Ref Sequence

ENSEMBL: ENSMUSP00000126464 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022271] [ENSMUST00000164598]

AlphaFold

Q9QXD1

Predicted Effect

probably benign
Transcript: ENSMUST00000022271
AA Change: I407T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000022271
Gene: ENSMUSG00000021751
AA Change: I407T

Domain	Start	End	E-Value	Type
Pfam:Acyl-CoA_ox_N	32	148	1.2e-28	PFAM
SCOP:d1is2a1	309	478	1e-28	SMART
Pfam:ACOX	492	677	3.2e-68	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000116361

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164412

Predicted Effect

probably benign
Transcript: ENSMUST00000164598
AA Change: I407T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000126464
Gene: ENSMUSG00000021751
AA Change: I407T

Domain	Start	End	E-Value	Type
Pfam:Acyl-CoA_ox_N	32	148	6.3e-29	PFAM
Pfam:Acyl-CoA_dh_M	150	260	2.8e-11	PFAM
SCOP:d1is2a1	309	478	1e-28	SMART
Pfam:ACOX	495	675	1.3e-60	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165169

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the acyl-CoA oxidase family. It encodes the branched-chain acyl-CoA oxidase which is involved in the degradation of long branched fatty acids and bile acid intermediates in peroxisomes. Deficiency of this enzyme results in the accumulation of branched fatty acids and bile acid intermediates, and may lead to Zellweger syndrome, severe mental retardation, and death in children. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice heterozygous for an endonuclease-mediated deletion exhibit no detectable phenotypic abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130213A22Rik	C	A	11: 69,121,475	G26*	probably null	Het
Abca5	T	A	11: 110,310,233	Y447F	probably damaging	Het
Adam8	T	C	7: 139,987,607	N408D	probably damaging	Het
Adgre1	A	T	17: 57,401,925	T39S	probably benign	Het
Akap12	G	A	10: 4,357,590	V1467I	probably benign	Het
Arid1b	T	A	17: 5,336,515		probably null	Het
Atp2c2	A	G	8: 119,735,296	I303V	possibly damaging	Het
Bpifc	C	T	10: 85,991,254	V144I	probably benign	Het
C530008M17Rik	A	G	5: 76,840,892	D30G	probably damaging	Het
Camk4	A	G	18: 33,158,854	E189G	possibly damaging	Het
Casz1	A	G	4: 148,939,589		probably benign	Het
Ccdc134	T	C	15: 82,131,442	V41A	possibly damaging	Het
Chrd	A	T	16: 20,738,910	T753S	probably damaging	Het
Cyb561a3	T	C	19: 10,585,371	V125A	probably benign	Het
D630039A03Rik	T	A	4: 57,910,606	T69S	probably benign	Het
Dchs1	A	G	7: 105,761,635	F1687S	probably damaging	Het
Dlgap4	T	C	2: 156,749,347	S818P	probably benign	Het
Dnah2	A	G	11: 69,429,348	I3965T	probably damaging	Het
Dnaic2	G	T	11: 114,732,955	G15W	probably damaging	Het
Dsg1c	A	G	18: 20,277,052	I526V	probably benign	Het
Far2	G	A	6: 148,150,591	E123K	probably benign	Het
Gli1	A	T	10: 127,330,219	V1055E	probably damaging	Het
Hand2	G	T	8: 57,321,976	A24S	probably benign	Het
Helb	T	C	10: 120,106,037	I249V	probably benign	Het
Hspa4l	G	A	3: 40,772,642	V492M	probably damaging	Het
Hspg2	T	C	4: 137,539,349	I1916T	probably damaging	Het
Igfals	G	A	17: 24,881,605	V557I	possibly damaging	Het
Itpa	T	G	2: 130,681,010	S176A	probably damaging	Het
Kcnu1	T	A	8: 25,885,317	L353H	probably damaging	Het
Klhl1	A	G	14: 96,518,179	F47L	probably benign	Het
Klhl13	T	C	X: 23,285,176	D21G	probably benign	Het
Krt26	T	C	11: 99,334,744	K304E	probably damaging	Het
Krt9	C	T	11: 100,190,849	V285I	probably damaging	Het
Mansc1	T	C	6: 134,610,183	R344G	possibly damaging	Het
Mier2	G	T	10: 79,541,797	P439T	possibly damaging	Het
Mppe1	T	A	18: 67,225,886		probably null	Het
Nedd4l	G	A	18: 65,167,535	A243T	probably benign	Het
Notch4	T	A	17: 34,578,069	C934*	probably null	Het
Nsmce3	C	T	7: 64,872,168	D251N	probably damaging	Het
Olfr101	T	A	17: 37,299,979	T148S	probably benign	Het
Olfr1156	T	A	2: 87,949,530	R234S	probably damaging	Het
Olfr1310	T	C	2: 112,008,323	T288A	possibly damaging	Het
Olfr139	A	G	11: 74,044,699	C192R	probably damaging	Het
Olfr517	C	T	7: 108,869,128	V9M	probably damaging	Het
Olfr937	A	G	9: 39,060,174	I164T	probably benign	Het
Pdzd7	T	C	19: 45,045,628	T6A	probably benign	Het
Picalm	T	A	7: 90,189,219	F493Y	probably damaging	Het
Prl7d1	A	G	13: 27,716,668	M1T	probably null	Het
Prl8a1	T	C	13: 27,575,458	K199E	possibly damaging	Het
Rims1	C	T	1: 22,428,489	R764H	probably damaging	Het
Rnf17	G	T	14: 56,475,413	R779L	possibly damaging	Het
Rufy2	T	C	10: 62,998,137	L294P	probably damaging	Het
Sgsh	A	G	11: 119,350,947	L111P	probably damaging	Het
Slc22a30	G	T	19: 8,336,849	T491K	probably benign	Het
Slc35b3	T	C	13: 38,943,068	N20D	possibly damaging	Het
Slc5a4a	T	C	10: 76,181,655	F429L	probably benign	Het
Sulf1	T	C	1: 12,817,412	I270T	probably damaging	Het
Tmem51	T	C	4: 142,031,748	T230A	probably damaging	Het
Tnc	T	A	4: 64,008,710	I860F	probably damaging	Het
Trh	A	T	6: 92,243,698	V61E	possibly damaging	Het
Ttn	T	G	2: 76,754,099	T22222P	probably damaging	Het
Uroc1	A	T	6: 90,361,512	K652*	probably null	Het
Usp34	C	T	11: 23,489,033	P3532S	possibly damaging	Het
Vmn2r120	A	T	17: 57,524,954	F278L	probably benign	Het
Vmn2r7	A	G	3: 64,719,611	F86L	possibly damaging	Het
Vmn2r87	A	T	10: 130,479,987	I70K	possibly damaging	Het
Vps13a	C	T	19: 16,744,953	A332T	probably benign	Het
Zfp568	T	A	7: 30,023,396	C589S	probably damaging	Het

Other mutations in Acox2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01530:Acox2	APN	14	8246363	missense	probably damaging	1.00
IGL01845:Acox2	APN	14	8251617	missense	probably damaging	1.00
IGL02830:Acox2	APN	14	8255298	missense	probably damaging	1.00
R0415:Acox2	UTSW	14	8243835	splice site	probably benign
R0535:Acox2	UTSW	14	8256753	missense	probably damaging	1.00
R1424:Acox2	UTSW	14	8230247	missense	probably benign	0.02
R1836:Acox2	UTSW	14	8248059	missense	possibly damaging	0.91
R1862:Acox2	UTSW	14	8241416	missense	probably benign	0.07
R1885:Acox2	UTSW	14	8248102	missense	probably benign	0.00
R2032:Acox2	UTSW	14	8246400	missense	probably benign	0.00
R2268:Acox2	UTSW	14	8253496	missense	probably damaging	0.98
R2497:Acox2	UTSW	14	8251612	missense	probably benign	0.00
R3032:Acox2	UTSW	14	8253466	missense	probably damaging	1.00
R3842:Acox2	UTSW	14	8251543	missense	probably damaging	1.00
R4763:Acox2	UTSW	14	8241334	missense	possibly damaging	0.81
R5072:Acox2	UTSW	14	8241374	nonsense	probably null
R5397:Acox2	UTSW	14	8243803	missense	probably benign	0.02
R5950:Acox2	UTSW	14	8255793	missense	probably benign
R7188:Acox2	UTSW	14	8252996	missense	possibly damaging	0.67
R7208:Acox2	UTSW	14	8241303	missense	probably benign	0.27
R7315:Acox2	UTSW	14	8256139	missense	probably damaging	0.99
R7757:Acox2	UTSW	14	8230166	missense	probably damaging	1.00
R7888:Acox2	UTSW	14	8246415	missense	probably benign	0.00
R8269:Acox2	UTSW	14	8246325	missense	probably benign	0.00
R8531:Acox2	UTSW	14	8247960	missense	probably damaging	1.00
R8536:Acox2	UTSW	14	8256081	missense	probably benign	0.00
R8782:Acox2	UTSW	14	8250035	missense	probably damaging	0.99
R8964:Acox2	UTSW	14	8243768	nonsense	probably null
R9183:Acox2	UTSW	14	8251559	missense	probably damaging	1.00
R9463:Acox2	UTSW	14	8256789	missense	probably damaging	1.00
R9466:Acox2	UTSW	14	8248092	missense	probably benign	0.12
Z1177:Acox2	UTSW	14	8256852	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- AAAGCTTACTTCCTCCGTGG -3'
(R):5'- TTTGTCTGCCACCTCACAAAAC -3'

Sequencing Primer
(F):5'- TCCCTGAATGGAACCTTAGGG -3'
(R):5'- CAGCATGGCACCAACCTC -3'

Posted On

2015-04-06