Incidental Mutation 'R7357:Unc13c'
ID571036
Institutional Source Beutler Lab
Gene Symbol Unc13c
Ensembl Gene ENSMUSG00000062151
Gene Nameunc-13 homolog C (C. elegans)
SynonymsMunc13-3, Unc13h3, 1500037O19Rik, D9Ertd414e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7357 (G1)
Quality Score217.468
Status Not validated
Chromosome9
Chromosomal Location73479422-73968966 bp(-) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) ATA to ATAGTA at 73933529 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]
Predicted Effect probably benign
Transcript: ENSMUST00000075245
SMART Domains Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1883 2023 2.6e-50 PFAM
C2 2058 2164 4.15e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184666
SMART Domains Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1882 2024 8.3e-59 PFAM
C2 2058 2164 4.15e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 97% (64/66)
MGI Phenotype PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik A T 2: 156,003,867 H23Q unknown Het
9530068E07Rik A T 11: 52,406,994 K233I probably damaging Het
Aldh1l2 T C 10: 83,514,544 M320V possibly damaging Het
C2cd3 A G 7: 100,430,103 N838S Het
Cacna1s T C 1: 136,071,021 F218S probably damaging Het
Carmil3 G T 14: 55,491,133 probably benign Het
Cd300a A T 11: 114,893,327 T54S probably benign Het
Celf3 G A 3: 94,480,330 E70K probably damaging Het
Celsr1 A C 15: 86,030,514 M1086R probably benign Het
Ces2f G A 8: 104,949,963 M96I probably benign Het
Chrdl2 G A 7: 100,029,207 V329I probably benign Het
Ctc1 T A 11: 69,034,742 L1035Q probably benign Het
Dbi A G 1: 120,119,893 probably null Het
Dock3 A G 9: 107,005,369 I405T probably benign Het
Dpp4 A T 2: 62,387,077 W59R probably benign Het
Dsg3 T A 18: 20,539,783 I837N probably damaging Het
Fbxw15 A G 9: 109,558,240 V229A probably benign Het
Fermt3 T C 19: 7,002,843 T395A probably benign Het
Focad A T 4: 88,229,335 I404F probably benign Het
Gm4869 A G 5: 140,495,051 R979G possibly damaging Het
Gm8104 T C 14: 43,101,611 I86T probably damaging Het
Gm9857 A C 3: 108,940,162 L95R unknown Het
Hoxa1 A T 6: 52,156,949 S266T probably benign Het
Leng8 T A 7: 4,144,933 Y625* probably null Het
Mast3 A G 8: 70,784,859 V557A probably damaging Het
Morc1 T C 16: 48,622,590 F813L probably benign Het
Ntf3 T A 6: 126,101,998 I182F probably damaging Het
Nup153 G T 13: 46,717,166 A91E probably benign Het
Olfr1402 G C 3: 97,410,655 N175K probably damaging Het
Olfr648 A T 7: 104,179,771 D212E probably damaging Het
Pamr1 G A 2: 102,586,704 W120* probably null Het
Pcsk1 A G 13: 75,125,960 N436S probably damaging Het
Pde4dip T C 3: 97,715,541 K1451E probably benign Het
Pebp4 G A 14: 70,048,415 V176I possibly damaging Het
Phgdh G A 3: 98,339,822 A4V probably benign Het
Pik3c2g T C 6: 139,633,793 probably null Het
Ppic T C 18: 53,411,067 Y82C probably damaging Het
Ppip5k2 A G 1: 97,759,216 V94A possibly damaging Het
Ppp1r9b T C 11: 95,004,598 V704A probably benign Het
Pramel6 G T 2: 87,510,512 R396L not run Het
Prss48 A T 3: 85,997,221 D223E probably damaging Het
Psd3 T C 8: 68,121,497 K11E probably benign Het
Rabgap1l T C 1: 160,342,038 K780E probably damaging Het
Retreg1 A T 15: 25,971,943 D323V probably damaging Het
Samd11 A T 4: 156,255,007 probably null Het
Sec14l3 T A 11: 4,070,127 F188Y probably benign Het
Serpina5 A T 12: 104,103,380 T284S possibly damaging Het
Setx A G 2: 29,130,301 D100G probably benign Het
Sis A T 3: 72,925,071 V1035D probably damaging Het
Slco4a1 A G 2: 180,472,137 I456V probably benign Het
Snx14 A T 9: 88,404,316 C393S possibly damaging Het
Stil T C 4: 115,014,226 probably null Het
Sult6b1 A G 17: 78,894,630 S148P probably damaging Het
Sycp2 G T 2: 178,403,804 probably null Het
Tesmin T C 19: 3,397,042 I273T probably benign Het
Tmem39a T A 16: 38,586,230 Y310N probably damaging Het
Trp53bp1 A T 2: 121,211,300 D1258E probably damaging Het
Ttc12 A C 9: 49,438,387 D703E probably benign Het
Usp18 T C 6: 121,253,849 I79T possibly damaging Het
Usp9y A T Y: 1,333,656 D1596E possibly damaging Het
Vmn2r109 A T 17: 20,541,274 V607E probably damaging Het
Vwa8 G A 14: 79,038,201 R808K probably null Het
Zfp248 A G 6: 118,429,657 Y324H probably damaging Het
Zfp513 G A 5: 31,199,788 P387S possibly damaging Het
Other mutations in Unc13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Unc13c APN 9 73736703 missense probably damaging 0.99
IGL00693:Unc13c APN 9 73758602 missense probably benign 0.18
IGL01022:Unc13c APN 9 73517328 missense probably benign 0.06
IGL01088:Unc13c APN 9 73932281 missense possibly damaging 0.63
IGL01123:Unc13c APN 9 73933197 missense probably benign 0.05
IGL01131:Unc13c APN 9 73564053 missense probably benign
IGL01135:Unc13c APN 9 73484893 missense probably damaging 1.00
IGL01393:Unc13c APN 9 73540270 missense probably benign 0.06
IGL01752:Unc13c APN 9 73931811 missense probably benign 0.01
IGL01893:Unc13c APN 9 73693366 missense probably benign 0.15
IGL01897:Unc13c APN 9 73546027 missense probably damaging 0.99
IGL01936:Unc13c APN 9 73693242 missense probably benign 0.07
IGL02122:Unc13c APN 9 73734397 splice site probably benign
IGL02341:Unc13c APN 9 73933210 missense possibly damaging 0.76
IGL02434:Unc13c APN 9 73932628 missense probably benign 0.01
IGL02545:Unc13c APN 9 73481075 missense probably damaging 0.98
IGL02709:Unc13c APN 9 73558956 missense probably benign 0.00
IGL02815:Unc13c APN 9 73540263 missense possibly damaging 0.83
IGL02904:Unc13c APN 9 73481067 nonsense probably null
IGL03117:Unc13c APN 9 73534025 missense probably benign 0.03
IGL03260:Unc13c APN 9 73931344 missense probably benign 0.11
PIT4431001:Unc13c UTSW 9 73749547 missense probably damaging 0.99
PIT4651001:Unc13c UTSW 9 73483739 missense possibly damaging 0.48
R0017:Unc13c UTSW 9 73693301 missense probably benign 0.07
R0039:Unc13c UTSW 9 73669565 splice site probably benign
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0308:Unc13c UTSW 9 73481118 missense probably benign 0.04
R0344:Unc13c UTSW 9 73930785 missense probably benign 0.39
R0421:Unc13c UTSW 9 73933210 missense possibly damaging 0.76
R0606:Unc13c UTSW 9 73530983 splice site probably benign
R0655:Unc13c UTSW 9 73930953 missense probably damaging 0.96
R1013:Unc13c UTSW 9 73933332 missense probably benign 0.45
R1293:Unc13c UTSW 9 73574074 missense probably benign 0.06
R1493:Unc13c UTSW 9 73639068 missense probably benign 0.27
R1675:Unc13c UTSW 9 73639050 critical splice donor site probably null
R1789:Unc13c UTSW 9 73756339 missense possibly damaging 0.92
R2001:Unc13c UTSW 9 73483615 splice site probably null
R2055:Unc13c UTSW 9 73736550 missense probably damaging 1.00
R2060:Unc13c UTSW 9 73665656 missense probably damaging 0.99
R2420:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2421:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2422:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R3415:Unc13c UTSW 9 73932586 missense probably benign 0.00
R3423:Unc13c UTSW 9 73930653 missense possibly damaging 0.46
R3820:Unc13c UTSW 9 73930958 missense probably benign 0.00
R3857:Unc13c UTSW 9 73699108 nonsense probably null
R3859:Unc13c UTSW 9 73699108 nonsense probably null
R3895:Unc13c UTSW 9 73933523 missense probably benign
R4038:Unc13c UTSW 9 73533906 critical splice donor site probably null
R4077:Unc13c UTSW 9 73736539 nonsense probably null
R4125:Unc13c UTSW 9 73574007 critical splice donor site probably null
R4128:Unc13c UTSW 9 73734537 missense probably damaging 1.00
R4235:Unc13c UTSW 9 73530952 missense possibly damaging 0.68
R4295:Unc13c UTSW 9 73734504 missense probably damaging 1.00
R4307:Unc13c UTSW 9 73693367 missense probably benign 0.06
R4658:Unc13c UTSW 9 73932826 missense probably damaging 1.00
R4694:Unc13c UTSW 9 73572354 missense probably benign 0.00
R4735:Unc13c UTSW 9 73693338 missense probably benign 0.00
R4744:Unc13c UTSW 9 73931844 missense probably damaging 1.00
R4795:Unc13c UTSW 9 73932187 missense probably damaging 0.97
R4827:Unc13c UTSW 9 73931286 missense probably damaging 1.00
R4838:Unc13c UTSW 9 73932072 missense possibly damaging 0.68
R4869:Unc13c UTSW 9 73680434 missense probably benign 0.02
R4873:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4875:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4876:Unc13c UTSW 9 73749539 missense probably damaging 1.00
R4905:Unc13c UTSW 9 73680392 missense probably benign
R4912:Unc13c UTSW 9 73574022 missense probably damaging 0.99
R5026:Unc13c UTSW 9 73930903 missense possibly damaging 0.74
R5127:Unc13c UTSW 9 73933372 missense probably benign 0.26
R5151:Unc13c UTSW 9 73931475 missense probably benign 0.02
R5171:Unc13c UTSW 9 73757954 missense probably benign
R5244:Unc13c UTSW 9 73525951 critical splice donor site probably null
R5342:Unc13c UTSW 9 73930823 missense probably benign 0.00
R5399:Unc13c UTSW 9 73749688 missense possibly damaging 0.95
R5409:Unc13c UTSW 9 73578390 missense possibly damaging 0.78
R5460:Unc13c UTSW 9 73545989 missense probably benign
R5680:Unc13c UTSW 9 73932602 missense probably damaging 1.00
R5681:Unc13c UTSW 9 73546075 splice site probably null
R5728:Unc13c UTSW 9 73558956 missense probably benign 0.01
R5762:Unc13c UTSW 9 73812367 missense probably benign 0.00
R5764:Unc13c UTSW 9 73533903 splice site probably null
R5829:Unc13c UTSW 9 73693368 missense probably benign 0.15
R5894:Unc13c UTSW 9 73693204 critical splice donor site probably null
R5936:Unc13c UTSW 9 73578492 missense probably damaging 1.00
R6043:Unc13c UTSW 9 73736651 missense possibly damaging 0.88
R6046:Unc13c UTSW 9 73930884 missense probably benign
R6148:Unc13c UTSW 9 73693366 missense probably benign 0.15
R6207:Unc13c UTSW 9 73758628 missense possibly damaging 0.89
R6277:Unc13c UTSW 9 73699169 missense probably damaging 1.00
R6338:Unc13c UTSW 9 73734447 missense probably damaging 0.99
R6615:Unc13c UTSW 9 73930608 missense possibly damaging 0.63
R6978:Unc13c UTSW 9 73931977 missense probably benign 0.39
R7053:Unc13c UTSW 9 73932297 missense probably damaging 1.00
R7223:Unc13c UTSW 9 73629191 missense probably benign 0.44
R7259:Unc13c UTSW 9 73517363 missense probably benign 0.00
R7353:Unc13c UTSW 9 73574073 missense probably benign 0.00
R7357:Unc13c UTSW 9 73933528 small insertion probably benign
R7607:Unc13c UTSW 9 73669535 missense probably damaging 0.98
R7626:Unc13c UTSW 9 73734517 missense probably damaging 1.00
R7639:Unc13c UTSW 9 73933168 missense probably damaging 0.99
R7657:Unc13c UTSW 9 73533903 splice site probably null
R7665:Unc13c UTSW 9 73680474 missense probably benign 0.28
R7704:Unc13c UTSW 9 73699212 missense probably benign 0.27
R7776:Unc13c UTSW 9 73694950 missense probably damaging 1.00
R7811:Unc13c UTSW 9 73693271 missense possibly damaging 0.46
R7833:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7839:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7869:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R7916:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7922:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7952:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R8047:Unc13c UTSW 9 73812354 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACAGGGAGAAGTCTTTGTGACC -3'
(R):5'- AGACCCTTGACCTTCCACAG -3'

Sequencing Primer
(F):5'- GTTCCGGGTAGATGAGCAC -3'
(R):5'- AGGAGCGCCATCCACTTTC -3'
Posted On2019-09-13