Incidental Mutation 'R0625:Arhgap22'
ID57437
Institutional Source Beutler Lab
Gene Symbol Arhgap22
Ensembl Gene ENSMUSG00000063506
Gene NameRho GTPase activating protein 22
SynonymsRHOGAP2, B230341L19Rik
MMRRC Submission 038814-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0625 (G1)
Quality Score160
Status Not validated
Chromosome14
Chromosomal Location33214026-33369934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33366714 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 219 (E219G)
Ref Sequence ENSEMBL: ENSMUSP00000107586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111955] [ENSMUST00000111956] [ENSMUST00000140711]
Predicted Effect probably benign
Transcript: ENSMUST00000111955
AA Change: E219G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000107586
Gene: ENSMUSG00000063506
AA Change: E219G

DomainStartEndE-ValueType
Blast:PH 18 57 6e-18 BLAST
RhoGAP 80 187 3.03e-7 SMART
low complexity region 307 318 N/A INTRINSIC
low complexity region 340 381 N/A INTRINSIC
low complexity region 388 398 N/A INTRINSIC
coiled coil region 447 526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111956
AA Change: E384G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107587
Gene: ENSMUSG00000063506
AA Change: E384G

DomainStartEndE-ValueType
PH 44 153 1.03e-24 SMART
RhoGAP 176 352 1.96e-65 SMART
low complexity region 472 483 N/A INTRINSIC
low complexity region 505 546 N/A INTRINSIC
low complexity region 553 563 N/A INTRINSIC
coiled coil region 612 691 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140166
Predicted Effect probably benign
Transcript: ENSMUST00000140711
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTPase activating protein family which activates a GTPase belonging to the RAS superfamily of small GTP-binding proteins. The encoded protein is insulin-responsive, is dependent on the kinase Akt and requires the Akt-dependent 14-3-3 binding protein which binds sequentially to two serine residues. The result of these interactions is regulation of cell motility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T C 9: 53,408,065 S2P probably benign Het
Abca16 A C 7: 120,435,893 T301P probably damaging Het
Acer2 A G 4: 86,887,162 D121G possibly damaging Het
Adgrd1 T C 5: 129,171,931 probably null Het
Arhgap11a T C 2: 113,841,711 I249V probably benign Het
C2cd4b T A 9: 67,759,751 S10T probably benign Het
Cnot6 A T 11: 49,683,171 I224N probably damaging Het
Ctrc T C 4: 141,841,518 T125A probably damaging Het
Cxxc5 T G 18: 35,858,589 S14R unknown Het
Cyp4f37 T G 17: 32,634,678 F445L probably damaging Het
Dcbld1 T G 10: 52,312,850 I186S probably benign Het
Dmxl2 T C 9: 54,382,702 T2510A probably benign Het
Dnah3 A G 7: 120,071,887 I591T possibly damaging Het
Dock5 A T 14: 67,841,163 I204N probably benign Het
Dysf G A 6: 84,111,987 probably null Het
Erich5 A G 15: 34,471,369 E248G probably damaging Het
Fam160a1 A G 3: 85,730,500 V164A possibly damaging Het
Foxm1 A G 6: 128,373,871 S712G probably damaging Het
Frmpd1 A G 4: 45,284,055 T959A probably benign Het
Gfra4 C T 2: 131,040,256 V277I probably null Het
Hacd4 T C 4: 88,435,010 I82V probably benign Het
Itih2 C T 2: 10,123,414 V159I possibly damaging Het
Itpr2 T A 6: 146,166,651 M2410L probably benign Het
March11 A G 15: 26,311,043 I202V probably damaging Het
March3 A G 18: 56,811,830 probably null Het
Med12l G A 3: 59,247,437 E1135K probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlx T C 11: 101,087,782 L78P possibly damaging Het
Muc5b T C 7: 141,846,427 C473R unknown Het
N4bp2l1 T A 5: 150,576,745 R66* probably null Het
Nes A G 3: 87,977,172 T913A possibly damaging Het
Oas1a T C 5: 120,899,259 E235G probably damaging Het
Olfr1104 T A 2: 87,021,620 H308L probably benign Het
Olfr477 T C 7: 107,991,189 S275P probably damaging Het
Olfr905 T C 9: 38,473,208 S154P possibly damaging Het
Parn C T 16: 13,640,294 V286I probably benign Het
Paxip1 G A 5: 27,765,942 Q470* probably null Het
Phc2 C G 4: 128,723,710 H510D possibly damaging Het
Pla2g4f T A 2: 120,305,041 D384V probably damaging Het
Plpbp A T 8: 27,045,131 N68I probably damaging Het
Podxl2 G A 6: 88,849,955 A123V possibly damaging Het
Pole A T 5: 110,325,550 T1737S possibly damaging Het
Ppp3cc T C 14: 70,225,027 E396G probably damaging Het
Pramel7 T A 2: 87,491,008 I228F probably benign Het
Prl7d1 A T 13: 27,710,140 C149S probably benign Het
Qtrt1 G T 9: 21,418,288 M217I probably benign Het
Sec24a T A 11: 51,729,454 D456V probably damaging Het
Shox2 T G 3: 66,981,544 probably null Het
Skint2 T A 4: 112,624,086 S49T probably damaging Het
Smarca5 A G 8: 80,720,686 probably null Het
Sorcs2 T A 5: 36,024,572 D1068V possibly damaging Het
Tmem114 T C 16: 8,412,102 probably null Het
Ttc7b T A 12: 100,355,046 M24L probably benign Het
Ttll3 A G 6: 113,408,903 probably null Het
Usp7 C T 16: 8,704,982 D102N probably benign Het
Other mutations in Arhgap22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02317:Arhgap22 APN 14 33359273 missense probably damaging 1.00
IGL02707:Arhgap22 APN 14 33363272 splice site probably benign
R0329:Arhgap22 UTSW 14 33369417 missense possibly damaging 0.55
R0330:Arhgap22 UTSW 14 33369417 missense possibly damaging 0.55
R0335:Arhgap22 UTSW 14 33359108 splice site probably benign
R0961:Arhgap22 UTSW 14 33367113 missense probably damaging 0.98
R1167:Arhgap22 UTSW 14 33343307 unclassified probably null
R1991:Arhgap22 UTSW 14 33366959 missense probably damaging 0.98
R3820:Arhgap22 UTSW 14 33367421 missense probably benign 0.41
R4377:Arhgap22 UTSW 14 33369510 missense probably damaging 0.99
R4670:Arhgap22 UTSW 14 33362543 missense probably damaging 1.00
R4671:Arhgap22 UTSW 14 33362543 missense probably damaging 1.00
R5177:Arhgap22 UTSW 14 33366693 missense probably benign 0.09
R5910:Arhgap22 UTSW 14 33366615 missense probably damaging 0.98
R7297:Arhgap22 UTSW 14 33271933 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTATTGCCACTTGCAGCCAACC -3'
(R):5'- TTATGAGCCAGTTCCCACCAGAGG -3'

Sequencing Primer
(F):5'- AACCTCTCCCTTTTATCACAGG -3'
(R):5'- GTACCTCTAAGGATGAGTTGACCC -3'
Posted On2013-07-11